AMBROSINO, CHRISTINE M.; TRICAS, TIMOTHY C. 2012
(CMA) Hawaii Institutte of Marine Biology; (TCT) University of Hawaii at Manoa, USA
Ampullary structure and receptor field dependent orientation in the scalloped hammerhead shark, Sphyrna lewini
Elasmobranch fishes use their ampullary electrosense to detect bioelectric dipole fields produced by hidden prey or potential mates. Gel-filled canals project from the ampullary subgroups and have unique somatotopic and spatial distributions. We tested the functional subunit hypothesis that predicts that different orientation behaviors are controlled by different ampullary groups. Premanipulation orientation behavior of juvenile Sphyrna lewini to electric dipole stimuli was recorded on video. Ampullary pores of two subgroups, the buccal (BUC) and superficial ophthalmic anterior (SOa), were then inactivated by application of a non-conductive jelly on the skin and tested again to observe changes in orientation behavior. This non-invasive jelly blockade of the electroreceptor system affected the shark‘s ability to orient to an electric field, but had no effect on feeding and swimming behavior. Orientation frequency decreased after subgroup inactivation in both BUC and SOa treatments. However, average orientation distance did not differ among the treatment groups. In unmanipulated sharks, the spiral and turn approach behaviors were most frequent. Sharks with the BUC pores inactivated showed decreased accuracy in spiral behavior. This indicates the animals were unable to accurately follow the dipole field lines to locate the simulated prey source. Sharks with the SOa pores inactivated demonstrated impaired initial field detection through increased overshoot behavior. These responses to the blockade of ampullary subgroups support the functional subunit hypothesis and demonstrate that the ampullary subgroups may play different roles in the electro-orientation behavior of sharks. Also, as the BUC and SOa treated sharks often missed biting in the proper target area, accurate orientation paths may require information summation from all ampullary subgroups.
ANDERSON, BRENDA; GELSLEICHTER, JIM; FRAZIER; BELCHER, CAROLYN. 2012.
(BA,JG) University of North Florida; (BF) South Carolina Department of Natural Resources, USA; (CB) Georgia Department of Natural Resources, USA
Evaluation of Gonadal Steroid Chemiluminescence Immunoassays (CLIA) for Non-lethal Characterization of Reproductive Status for Elasmobranchs
Information regarding reproductive biology is an important element needed in the management of shark fisheries. Characterization of reproductive cycles has historically involved culling many individuals to examine gross morphology to assign reproductive status. This practice, while necessary at first, is counterproductive to the conservation of these populations. Nonlethal alternatives for determining status include using blood samples to determine sex hormone concentrations, typically using radioimmunoassays (RIA). However, RIAs are often problematic for many researchers because of the use of radioactive isotopes, the need for large sample volumes, and time and equipment needed for pre- extraction are intensive. Commercially available chemiluminescence immunoassays (CLIA) are routinely used for human plasma steroid evaluation, but have not been previously examined for use with shark plasma. CLIAs use small sample volumes, equipment used is found readily in most laboratories, and pre- extraction is typically not necessary. In this study, we validated the use of CLIAs for the gonadal steroids 17β-estradiol, testosterone, and progesterone for examining reproductive endocrinology of elasmobranchs, focusing on the bonnethead shark ( Sphyrna tiburo ) and the blacknose shark ( Carcharhinus acronotus ). Plasma steroid concentrations measured using CLIA were compared to morphological/histological assessments of reproductive status from a subset of culled specimens in both species as well as to previous measurements of plasma steroid concentrations determined via RIA in S. tiburo. Measurements of gonadal steroids using CLIA were generally higher than those previously measured using RIA in S. tiburo . However, seasonal changes in CLIA-determined plasma steroid concentrations were consistent with those determined using RIA and with morphological assessments of reproductive status. C. acronotus male testosterone CLIA concentrations were consistent with morphological assessments as well. However, 17β-estradiol CLIA concentrations showed an unpredictable seasonal pattern in female C. acronotus . Therefore, CLIA appears to be a reliable method for determining reproductive status in S. tiburo males and females and C. acronotus males but the variability in female C. acronotus morphology and reproductive status may lend to inconsistent 17β- estradiol CLIA concentrations.
ANDERSON, JAMES; JOHNSON, RYAN; BESTER, MARTIN; SWANSON, STEPHEN; GENNARI, ENRICO. 2012.
(JA) University of Hawaii Institute of Marine Biology; (RJ,SS) Oceans Research, Canada; (MB) University of Pretoria, South Africa; (EG) Rhodes University, USA
Impact of small scale chumming activities on the movement patterns of white sharks (Carcharodon carcharias) in Mossel Bay, South Africa
Shark cage diving has become both a popular and controversial activity at numerous locations around the world. Such activities are widely argued to have economic and educational values with minimal impacts upon a natural resource. Critics of the cage diving industry claim increased risks for public safety, as well as environmental and ecological impacts. In South Africa, the cage diving industry is largely focused on the white shark (Carcharadon carcharias) at three main centers; Mossel Bay, Gansbaai and False Bay. It is documented that at least 15% of the white shark population in these areas move between these sites, whilst Mossel Bay supports a semi-resident population of female white sharks, that may stay in the area for upwards of six months. Movements of white sharks (n=15) in Mossel Bay were analyzed in relation to the activity of the sole cage diving operator between 2005 & 2009. Sharks were tracked over several days both with and without concurrent cage boat activity. Putative behavioral change was observed in individual sharks both in relation to the activity of the cage boat and as a function of experience. The study demonstrates natural behavioral patterns of sharks may be altered by methods employed by cage dive vessels (chumming), but such behavioral changes may be short term and reversible. No reliable evidence was gained to either support or refute that such behavioral change conveys increased risks for public safety, or may have long term ecological impacts.
ANDERSON, JAMES; MANOI, KEHAU; DONACHIE, STUART; HOLLAND, KIM. 2012.
(JA,KH) University of Hawaii Institute of Marine Biology; (KM,SD) University of Hawaii at Manoa, USA
Investigating ecological connectivity between distinct elasmobranch populations using oral bacteria: A proof of concept study
Ecological connectivity is a term used in reference to the movement of organisms from one place or habitat to another. In a marine context, understanding ecological connectivity has important applications in conservation, and in fisheries management and planning. A synthesis of knowledge from satellite tag derived movement data, as well as biophysical modeling largely focusing on larval dispersal and reproductive phenology demonstrates a level of inter and intra-specific connectivity in marine environments at differing scales. These approaches have some significant drawbacks including equipment costs, difficulty of data recovery, and life-history specificity. This project begins to address connectivity among elasmobranch species through the analysis of oral bacteria cultivated from the teeth of live, line-caught sharks. Analysis of oral micro-flora will determine the utility of this concept for elucidating connectivity. Here we aim to describe bacteria, yeasts and fungi cultivated from the teeth of prevalent shark species caught in waters around the Main Hawaiian Islands. We aim to isolate specific marker species to provide real-time evidence of connectivity between elasmobranchs at both species and population levels. These data can be compared with satellite derived movement and habitat-use data to elucidate possible connectivity.
BANGLEY, CHARLES. 2012.
East Carolina University
Potential competitive and predatory interactions between spiny dogfish (Squalus acanthias), and striped bass (Morone saxatilis) in the coastal waters of North Carolina.
Spiny dogfish and striped bass are high-level predators in the Northwest Atlantic ecosystem that have recently recovered from overfishing, and both species overwinter in North Carolina waters. Striped bass and spiny dogfish abundance, salinity, temperature, and depth data were taken from winter trawl surveys conducted in North Carolina waters from 1996-1998 and 2006-2010. Diet data were collected from striped bass in 2006-2007 and from spiny dogfish in 2006-2007 and 2010. Spatial and dietary overlaps were determined between the two species and the importance of striped bass in the diet of spiny dogfish was assessed. Spatial overlap was consistently high and abundance was more strongly correlated with environmental factors than the abundance of the other predator. Dietary overlap was less than 40% between striped bass and dogfish sampled in 2006-2007 but was over 84% between striped bass and spiny dogfish sampled in 2010. Atlantic menhaden (Brevoortia tyrannus) and bay anchovy (Anchoa mitchilli) were the most important overlapping prey species. Spiny dogfish in North Carolina waters may have consumed 0.91% of the striped bass stock during the winter. These data suggest that spiny dogfish are occasional predators of striped bass and there is potential for competition between the two predators, but these interactions are insufficient to affect the abundance and distribution of either species. However, the stability of these interactions may depend on the availability of their shared prey.
BEDORE, CHRISTINE; LOEW, ELLIS; KAJIURA, STEPHEN. 2012.
(CB,SK) Florida Atlantic University, Boca Raton, FL, United States; (EL) Cornell University, Ithaca, NY, United States
Can batoids see in color? Multiple cones types are present in two batoid elasmobranchs
Elasmobranch fishes have adapted to nearly every marine environment, many of which are spectrally distinct. Whereas the deep sea is light limited and consists of almost exclusively blue wavelengths, coral reefs are among the most colorful environments on the planet. Elasmobranchs have evolved optimal visual capabilities for their diverse spectral environments. The cownose ray ( Rhinoptera bonasus ) and the yellow stingray ( Urobatis jamaicensis ) are two batoid elasmobranchs that inhabit diverse spectral habitats which likely reflect their potential for color discrimination. The cownose ray inhabits turbid, coastal waters typically dominated by green wavelengths, whereas the yellow stingray inhabits coral reef environments that are blue dominated, but spectrally diverse. Therefore, the yellow stingray is more likely to be capable of color vision than the cownose ray. Additionally, ultraviolet (UV) light is present in both environments, so it is possible that one or both species possess the ability to see UV wavelengths. The maximum absorbance of photoreceptors from two individuals of each species was analyzed using microspectrophotometry (MSP). Both rays possessed rod-dominated retinas with a λ max near 500nm (green), but differed in the number of photopigments. The yellow stingray had three distinct cone types with maximal absorbance in blue (475nm), green (533nm), and yellow (562nm) regions of the visible spectrum whereas the cownose ray had two distinct cone types with maximal absorbance in blue (470nm) and yellow (551) regions. Neither species showed evidence for UV sensitivity in MSP analysis. The light filtering effects of the ocular media (cornea and lens) were quantified by measuring transmitted wavelengths of broad-spectrum white light (400-800nm) and UV rich light (<400nm). Both rays transmitted visible light through the ocular media, however, most UV light was absorbed by the lens in both species. Cownose rays blocked transmission of all wavelengths below 400nm, whereas yellow stingrays transmitted some UV wavelengths, but absorbed all wavelengths below 385nm. Although both rays possessed multiple cone types, it is likely that the two cone types in the cownose ray enhance contrast detection, rather than function for color discrimination. Conversely, the trichromatic yellow stingray likely possesses true color vision.
BELLEGGIA, MAURO; FIGUEROA, DANIEL; SÁNCHEZ, FELISA; BREMEC, CLAUDIA. 2012.
(MB) CONICET – UNMdP; (DF) UNMdP; (FS) INIDEP; (CB) CONICET
The diet of Mustelus schmitti; a comparison across decades
The diet of the narrownose smoothhound shark Mustelus schmitti was studied based on analysis of stomach contents from two disparate time periods from specimens on the northern Argentinean continental shelf (34 o S – 41 o S): The first set of specimens was collected from fifteen research cruises carried out by INIDEP from 1986-1994, total length ranged between 250-1050 mm. The second set of specimens was collected from eight research cruises from 2008-2011, total length ranged between 250- 1050 mm. Prey items were identified to the lowest possible taxonomic level, counted and weighted. For comparisons, %IRI and the new %PSIRI were calculated. The hypothesis that the consumption of each prey group is determined by intrinsic (total length, sex, maturity) and extrinsic factors (region, season, period) was assessed by fitting generalized linear models (GLMs). Of the 1009 stomachs analyzed during the older period, 902 (89.39%) contained prey items. On the other hand, of a total of 959 stomachs sampled during the contemporary period, 944 (98.43%) contained food. Only the stomachs containing prey were analyzed further. The stomach contents of the narrownose smoothhound M. schmitti indicate opportunistic foraging behavior. The specimens caught between 1986 and 1994 fed mostly on Brachyura crustaceans (65.53%), followed by polychaetes (13.42%) and fishes (12.23%). The diet of those animals caught between 2008 and 2011 was composed mainly of polychaetes (38.12%) and Brachyura crustaceans (30.64%), followed by fishes (17.82%). Hermit crabs were rare during the older period (0.08%) but become more frequent during the recent years (7.38%). The trophic level is the position of an organism within the food web; it ranged between 3.76-3.92 during the older period and between 3.59-3.75 during the contemporary period.
BERNARD, ANDREA; FELDHEIM; HEITHAUS, MICHAEL; WINTNER, SABINE; WETHERBEE, BRAD; SHIVJI, MAHMOOD. 2012.
(BA) Save Our Seas Shark Center USA & Guy Harvey Research Institute; (KF) The Field Museum of Natural History, Pritzker Laboratory for Molecular Systematics and Evolution, Chicago, IL, United States; (MH) Florida International University, North Miami, FL, United States; (SW) KwaZulu-Natal Sharks Board, N/A, South Africa; (BW) University of Rhode Island, Kingston, RI, United States; (MS) Guy Harvey Research Institute & Save Our Seas Shark Center, Dania Beach, FL, United States.
Population genetic structure and evolutionary history of the tiger shark (Galeocerdo cuvier) on a global scale
The tiger shark (Galeocerdo cuvier) is a globally distributed, migratory species inhabiting warm-temperate and tropical waters. With their large size, generalist feeding habits and broad habitat distribution ranging from coastal to pelagic environments, tiger sharks likely play an important role as apex predators in marine ecosystems. Recent evidence indicates over-exploitation and population decline of this species in some regions. We report on the global population structure and evolutionary history of tiger sharks inferred from a combination of 10 nuclear microsatellite loci (n = 389 animals) and sequences of the mitochondrial control region (mtCR) (1,068 bp; n = 349) and cytochrome oxidase I gene (642 bp; n = 152). Strong genetic differentiation was detected among western Atlantic and Indo-Pacific tiger sharks with all three sets of genetic markers, with limited inter-basin mixing. However, some contrasting patterns of intra-basin structure were detected across mitochondrial and nuclear markers, with mtCR sequences generally indicating increased genetic partitioning within ocean basins. Tiger sharks from the Indian and Pacific Ocean coasts of Australia were significantly differentiated based on mtCR but not nuclear markers. Coalescent based analyses and mtCR sequence diversity estimates were largely congruent and suggestive of an Indo-Pacific origin for tiger sharks, with subsequent colonization of the Atlantic Ocean during the mid to upper Pleistocene via dispersal around South Africa. This work supports the assessment and management of tiger sharks from the western Atlantic and Indo-Pacific separately, and points to the need for further investigation of smaller-scale population structure within ocean basins.
BERNARD, ANDREA; HORN, REBEKAH; CHAPMAN, DEMIAN; FELDHEIM, KEVIN; BROOKS, EDD; GORE, MAUVIS; SHIVJI, MAHMOOD. 2012.
(AB) Save Our Seas Shark Center USA & Guy Harvey Research Institute; (RH) 1Save Our Seas Shark Center USA & Guy Harvey Research Institute, Dania Beach, FL, United States; (DC) School of Marine and Atmospheric Science & Institute for Ocean Conservation Science, Stony Brook, NY, United States; (KH) The Field Museum of Natural History, Pritzker Laboratory for Molecular Systematics and Evolution, Chicago, IL, United States; (EB) Shark Research and Conservation Program, N/A, Bahamas; (MG) Marine Conservation International, N/A, United Kingdom; (MS) Save Our Seas Shark Center USA & Guy Harvey Research Institute, Dania Beach, FL, United States.
The genetic population structure of the Caribbean reef shark (Carcharhinus perezi)
Ecological and community differences have been noted across coral reef ecosystems with varying levels of anthropogenic intrusion, with striking declines of apex predator densities documented where human presence has historically been the highest. Within western Atlantic waters, one of the most common predators inhabiting coral reef ecosystems is the Caribbean reef shark (Carcharhinus perezi). Given the vulnerability of this species to fisheries and its potentially important ecological role as an apex predator, we assessed the overall genetic diversity and connectivity across its tropical western Atlantic distribution using both nuclear and mitochondrial DNA. Caribbean reef sharks demonstrated extremely low levels of genetic diversity across all surveyed loci relative to all other shark species analyzed to date, which may be due to a recent evolutionary origin. Nevertheless, nuclear microsatellite loci revealed population structure between Brazilian sites and populations from The Bahamas and Caribbean Sea (FST > 0.0182; P 0.05). In contrast, concatenated mitochondrial and mitochondrial/nuclear sequences revealed low but significant genetic differentiation across most of the surveyed locations. These patterns may reflect either historical patterns of dispersal or contrasting patterns of movement between male and female sharks. Although tagging and tracking data suggest these animals typically exhibit strong site attachment, our study reveals complex population structure with evidence supporting contemporary long distance mixing, at least by males, which should be incorporated into management plans for this species.
BIGMAN, JENNIFER; BIZZARRO, JOSEPH; EBERT, DAVID. 2012.
(BIGMAN,DE) Moss Landing Marine Laboratories; (BIZZARRO) Friday Harbor Laboratories, Friday Harbor, United States
North Pacific spiny dogfish (Squalus suckleyi) trophic ecology: using integrated gut content and stable isotope analysis to infer short and long term feeding trends
North Pacific spiny dogfish (Squalus suckleyi) are commercially and ecologically important predators that are abundantly distributed in North Pacific waters, and therefore may play an important role in regional marine ecosystems. Most historic research on this species has been focused on dogfish collected within the inland waters of Washington and British Columbia, but little is known about offshore populations. We used traditional gut content analysis (GCA) and stable isotope analysis (SIA) to elucidate the trophic ecology of dogfish from central California, U.S.A. GCA allows for quantification of prey items contained within the stomach of a single individual and reveals what actual species are consumed on a short-term basis. SIA uses elements as tracers (specifically carbon and nitrogen) to identify predator-prey relationships as well as trophic position, allowing for long-term diet information. SIA analysis can be used to complement gut content data via integrating both short and long term food habits, enhancing information known about the trophic role of a given species. Based on GCA, the most abundant and important prey taxa by number, weight, and the prey-specific index of relative importance were euphausiids, fishes, and cephalopods. Similarly, the most frequently occurring prey taxa were fishes, euphausiids, and cephalopods. In addition to diet composition, sources of dietary variability with respect to size, sex, depth, location, season, and year are being investigated for GCA and SIA and will be presented.
BIGMAN, JENNIFER; EBERT, DAVID (MOSS LANDING MARINE LABS, MOSS LANDING, CA, UNITED STATES); DEWAR, HEIDI; BIZZARRO, JOSEPH; KOHIN, SUZANNE; VETTER, RUSS. 2012.
(JB,DE) Moss Landing Marine Laboratories, Moss Landing, CA, USA; (HD, SK,RV) Southwest Fisheries Science Center, NOAA Fisheries, La Jolla, CA, United States; (JB) Friday Harbor Labs, Friday Harbor, CA, United States
Spot a basking shark: how California’s citizen scientists can aid in the recovery of an enigmatic shark
The basking shark (Cetorhinus maximus) is the second largest shark species, reaching a total length of up to 10 m. It has been reported globally from high latitude seas, including Arctic waters, to the tropics. The eastern North Pacific basking shark population was recently designated a ―Species of Concern‖ by the National Marine Fisheries Service (NMFS) for three main reasons: (1) notable, although largely anecdotal, population declines; (2) a lack of recovery even after long-term cessation of fishery exploitation; and (3) a severe lack of biological and fisheries data. Although thousands of basking sharks were observed off the West Coast of the continental US and Canada in the early 1900‘s, individual sightings are now uncommon and large aggregations and extremely rare and much reduced compared to historic records. There have been no directed fisheries for basking sharks in the eastern North Pacific for more than 50 years, but there does not appear to be any notable increase in population size. It is unclear if this situation is a result of persistent, undocumented mortality, the naturally low intrinsic population growth rates of basking sharks, and/or potential changes in contemporary distribution patterns. However, regardless of the cause, a general lack of recovery following the cessation of fishing is common worldwide. Without adequate knowledge of basking shark biology (e.g., movement patterns, nursery and feeding grounds, demography) or fishery exploitation, it has been extremely difficult to develop a recovery plan for this species in the eastern North Pacific. To address this lack of knowledge, a collaborative project was initiated in April 2011 between the NMFS and the Pacific Shark Research Center to investigate spatial aspects (e.g., distribution, abundance, occurrence, movement patterns) and population status of eastern North Pacific basking sharks. This project has many facets including an outreach program, tagging, data-mining, and a sightings network that have contributed to its success and will be addressed in the upcoming oral presentation. The ultimate goal of this project is to provide necessary baseline information for the formulation of an effective recovery plan for basking sharks in the eastern North Pacific.
BLASIUS, MARY; MULL, CHRIS; LYONS, KADY; O’SULLIVAN, JOHN; LOWE, CHRIS. 2012.
(MB,KL,CL) California State University Long Beach, USA; (CM) Simon Fraiser University, Canada; (JO) Monterey Bay Aquarium, Canada
Bioaccumulation and maternal transfer of organic contaminants and mercury in young of the year white sharks (Carcharodon carcharias)
Organic contaminants and total mercury were measured in young of the year (YOY) white sharks ( Carcharodon carcharias ) incidentally caught in southern California between 2005 and 2010. DDT and PCB concentrations were higher in liver (76 ± 87 μg/g ww and 14 ± 10 μg/g, respectively) than in red (0.05 ± 0.04 μg/g) or white muscle (0.24 ± 0.34 μg/g). Total mercury was higher in white and red muscle tissue (1.40 ± 1.12 μg/g and 1.90 ± 1.35 μg/g, respectively) than in liver (0.19 ± 0.16 μg/g). These levels were alarmingly high considering their young age and diet, suggesting these sharks are more likely acquiring these high levels from their mothers in utero . To examine the YOY‘s potential of maternal transfer of these persistent organic pollutants, a five-parameter bioaccumulation model was used to estimate the total loads a newborn shark would accumulate over a one year period from consuming highly contaminated prey. Contaminant consumption was based on levels representative of fish prey common in southern California. Based on the model, the maximum potential levels that YOY white sharks could attain from dietary exposure are 11.17 μg/g ∑DDT, 0.6 μg/g ∑PCBs, and 2.14 μg/g Hg. Observed organic contaminant levels in YOY sharks were 7 fold higher for PCBs and 23 fold higher for DDT than the maximum output of our model. Since it is unlikely these YOY sharks are acquiring such high levels from diet alone (especially for DDT and PCBs), this suggests maternal transfer of contaminants is a major contributing process to YOY white shark body burdens. Despite signs of population recovery in the eastern Pacific, anthropogenic impacts via biomagnification and maternal offloading of environmental contaminants may have future impacts on apex predator populations located around urbanized areas.
BOLAÑO MARTÍNEZ, NATALY; DÍAZ JAIMES, PÍNDARO; URIBE ALCOCER, MANUEL; GALVAN MAGAÑA, FELIPE. 2012.
(NBM) Universidad Nacional Autónoma de México; (PDJ,MUA,FMG) Universidad Nacional Autónoma de Mèxico, Mexico
Philogeography and population genetics of the hammerhead shark Sphyrna zygaena in the Oriental Pacific Ocean
Sphyrna zygaena lives in costal a pelagic zones and it is usually found in tropical and subtropical areas including the Mediterranean Sea (Compagno, 1984; Castro, 1983). In te Oriental Pacific Ocean its distributed along the occidental coasts of Baja California, Golfo de California, Islas Galápagos, Panama and Patagonia. It presents a discontinues distribution in the mexican Pacific and Centralamerica. Is the most important species in fisheries. It is possible that due to its distribution in the Pacific two populations might be coexisting one in the Nothern Hemisphere and a second in the South. By using molecular markers we pretend to determine if there is a genetic flux between the two populations. If this flux do exist might be limited or might not exist. In this case we will be having two discrete populations therefore our main goals are: 1) to evaluate the genetic structure of S. zygaena all along the Oriental Pacific; 2) to determine its genetic variability using both mitochondrial and nuclear markers and 3) to define a philogeographic pattern. We have obtained 376 biopsys between Baja California Sur, Nayarit, Colima, and Chiapas in Mexico; from Ecuador and Chile. Until know we have 136 analyzed sequences with D- loop (Primer SPH_F: ACCGGTTTTTGTACGTCAGT), we have found 7 haplotypes. Of this 7 haplotypes we found 5 in Chile population in which three of them are exclusive of this population. For the Mexican population found one exclusive and for the Ecuador population we found 3 haplotypes and 1 exclusive. Nucleotidic and haplotypic diversity were calculated Hd :0.60 and π:0.001. To determine de genetic flux between the two apparent populations FST values were calculated (FST: 0.87) this indicates that there are genetic differences between North and South populations but we have not found yet differences among groups ( North = Mexico (B.C.S, Coliman and Nayarit) and South = Chile and Ecuador (Manta and Santa Rosa)).
BOND, MARK; BABCOCK, ELIZABETH; PIKITCH, ELLEN; CHAPMAN, DEMIAN. 2012.
(MB,EP,DC) School of Marine and Atmospheric Sciences, Stony Brook University; (EB) Rosenstiel School of Marine and Atmospheric Science, Univerity of Miami, USA
Differences in elasmobranch assemblages between marine reserves and fished reefs on the Mesoamerican Barrier Reef
Our previous research has shown that Caribbean reef sharks (Carcharhinus perezi) are significantly more abundant inside marine reserves when compared to similar fished reefs on the Mesoamerican Barrier Reef. We now pose the question: what effect have marine reserves had on the abundance of other elasmobranchs, such as batoids? Rays, including the southern stingray (Dasyatis americana), spotted eagle rays (Aetobatus narinari), Caribbean whip-ray (Himuntura schmardae) and yellow stingray (Urobatis jamaicensis) are not commercially targeted by fisherman in Belize. An appropriate null hypothesis is that marine reserves have no effect on the relative abundance of these species. Baited Remote Underwater Video (BRUV) surveys were conducted on the fore-reef at four sites along the Mesoamerican barrier reef in Belize, at two established marine reserves and two fished reefs (N=50 per site). Of the combined 100 deployments at the two reserve sites 13 batoids were observed compared to 58 observed at the two fished sites. We constructed a generalized linear model (GLM) to explain the presence of batoids on BRUVs, which included ―marine reserve‖, ―location nested within marine reserve‖, habitat characteristics and several environmental variables as potential factors. The GLM found that the factor ―marine reserve‖ had a significant negative effect on the presence of batoids, while none of the habitat or environmental variables had a significant influence (p>0.002). We discuss ongoing research aimed at explaining this pattern, including potential mechanisms such as (1) mesopredator release due to reduced predation from reef sharks, (2) altered batoid behavior due to intimidation by sharks inside reserves and (3) increased competition for prey inside marine reserves.
BONFIL, RAMON; O’BRIEN, SHANNON. 2012.
(RB) Bronx High School of Science; (SO) University of Washington, USA
First Adult Female White Shark is Tracked Using Real-Time Satellite Tags in Guadalupe Island, Mexico
Despite recent advances in our understanding of the spatial behavior of great white sharks, Carcharodon carcharias, real-time tracks of their movements including oceanic migrations remain rare. Due to the difficulty and risk of deploying real-time satellite tags on large great white sharks available data is restricted to juveniles and one single mature male. Here, we report on the first ever adult female great white shark tracked with a real-time satellite tag. A 5.1 m total length female great white shark was tagged with a SPOT tag in Guadalupe Island, Baja California, Mexico on October 16, 2006 and tracked intermittently for a total of 288 days and 7,100 km as she traveled in a large area of the North East Pacific Ocean. The female great white shark remained in the vicinity of the NE coast of Guadalupe Island moving between the east and west coasts for the next three and a half months; a preference for the north east coast was suggested by the data. The shark left Guadalupe Island at the beginning of February on a ca. 3,900 km westward migration. The route followed by the shark showed remarkable directional movement to a distinct region 790 km north-northeast of the Hawaiian Islands. During the next four months the shark roamed in this area (ca. 680 km wide) following an irregular search-like pattern. This area is previously unknown as a point of interest for great white sharks in North East Pacific and different from the previously reported ̳white shark café‘. Temperature data were intermittently transmitted by the tag and are also presented. This study shows that real-time satellite tags provide unique and important information for studying the spatial dynamics of great white sharks and suggests that white sharks have remarkable navigation abilities and confirms that not all adult great white sharks in the NE Pacific make use of the ‘White Shark Café’.
BOSWELL, LEIGH ANN; TRICAS, TIMOTHY. 2012.
(LAB,TT) Department of Zoology, University of Hawai’i / Hawai’i Institute of Marine Biology, Honolulu, HI, United States
Identity and density of olfactory receptor neurons in the nasal epithelium of juvenile hammerhead sharks, Sphyrna lewini
Aquatic toxicants can damage the fish peripheral olfactory system and cause deficits in fitness-related behaviors such as feeding, predator avoidance, and mate recognition. However, the response of the shark olfactory system to toxicants, and for many species the type, density, and total number of olfactory receptor neurons (ORNs) involved in odorant detection, are still unclear. The olfactory rosette organ was examined by histology in the juvenile scalloped hammerhead, Sphyrna lewini , to identify and quantify the ORNs present in their chemosensory epithelium. Microvillar ORNs (mORN) and crypt neurons (CN) occur in all horizontal sections of the rosette. Cell bodies of mORNs have a circular shape and mean diameter of 7.2 ± 0.5 μm, highest densities in the mid regions of the sensory epithelium, and an average density of 23,552 ± 8,198 cells/mm 2 . Cell bodies of CNs have a smaller kidney-shape and mean diameter of 5.3 ± 0.7 μm, and lower density of 523 ± 944 cells/mm 2 . The primary lamellae epithelial surface area of both olfactory organs is estimated at 6,010 mm 2 for a 56.1 cm TL juvenile. These combined estimates indicate that a 56.1 cm TL juvenile S. lewini has a putative total of at least 142,000,000 mORNs and 3,00,000 CNs, and is higher when secondary lamellae and surface area of adult sharks are considered. The total number of olfactory receptors range from 3-7 million in teleosts, 2.5 million in humans, and 220 million to 2 billion in canines. Thus this first estimate of total olfactory receptors for S. lewini is in great excess to that reported for other fishes examined so far and is closer to that of canines. These results provide only the second example of a shark species containing two ORNs in the olfactory organ and give the first quantitative densities of each ORN type throughout the primary lamellae of the peripheral olfactory system. This research provides the quantification of ORNs necessary to determine epithelial degradation after toxicant exposure based on changes in ORN densities.
BRANDLEY, MATTHEW; THOMPSON, MICHAEL; WAGNER, GUNTER. 2012.
(MB) University of Sydney; (MT) University of Sydney, Australia; (GW) Yale University, USA
Gene expression associated with pregnancy in a viviparous skink
Although the morphological and physiological changes involved in pregnancy in live-bearing reptiles are well studied, the genetic mechanisms that underlie these changes are not known. We used the viviparous African Ocellated Skink, Chalcides ocellatus , as a model to identify a near complete gene expression profile associated with pregnancy using RNA-Seq analyses of uterine transcriptomes. Pregnancy in C.ocellatus is associated with upregulation of uterine genes involved with metabolism, cell proliferation and death, and cellular transport. Moreover, there are clear parallels between the genetic processes associated with pregnancy in mammals and Chalcides in expression of genes related to tissue remodeling, angiogenesis, immune system regulation, and nutrient provisioning to the embryo. In particular, the pregnant uterine transcriptome is dominated by expression of proteolytic enzymes that we speculate are involved both with remodeling the chorioallantoic placenta and histotrophy in the omphaloplacenta. Elements of the maternal innate immune system are downregulated in the pregnant uterus, indicating a potential mechanism to avoid rejection of the embryo. We found a downregulation of major histocompatability complex loci and estrogen and progesterone receptors in the pregnant uterus. This pattern is similar to mammals, but cannot be explained by the mammalian model. The latter finding provides evidence that pregnancy is controlled by different endocrinological mechanisms in mammals and reptiles. Finally, 88% of the identified genes are expressed in both the pregnant and non-pregnant uterus, and thus morphological and physiological changes associated with C. ocellatus pregnancy is likely a result of regulation of genes continually expressed in the uterus rather than the initiation of expression of unique genes.
BROOKS, EDWARD; BROOKS, ANNABELLE; WILLIAMS, SEAN; CHAPMAN, DEMIAN; HOWEY, LUCY; JORDAN, LANCE; ABERCROMBIE, DEBRA; GRUBBS, DEAN. 2012.
(EB,AB,SW) Cape Eleuthera Institute, Rock Sound, Bahamas; (DC) Stony Brook University, Stony Brook, United States; (LH,JL) Microwave Telemetry, Columbia, United States; (AD) Abercrombie and Fish Consulting, Port Jefferson Station, United States; (DG) Florida State University, St. Teresa, USA
The diversity, distribution and demographic population structure of deep water elasmobranchs in the northeast Exuma Sound, the Bahamas
There is a fundamental lack of basic taxonomic, biological and ecological information pertaining to the majority of deep water species, in particular elasmobranchs, largely due to the logistical challenges of sustained ecological investigation in this remote and hostile ecosystem. The Exuma Sound is a deep water inlet of the Atlantic Ocean ranging in depth from 500 – 2000 m and characterized by steep walls along its margin. The sound is in close proximity to land (<3 km), facilitating the sustained investigation of its deep water elasmobranch fauna over extended periods of time. A total of 69 deep water longline surveys were conducted from September to December in both 2010 and 2011 (depth: 472.6 – 1024.1 m; seabed temperature: 15.6 – 5.9 °C), resulting in the capture of 144 sharks of at least eight different species. This does not include a potentially new species of Centrophorus currently undergoing morphological and genetic assessment. Elasmobranch species richness declined significantly with increasing distances from the edge of the Exuma Sound (ρ = -0.295, p = 0.014), increasing depth (ρ = – 0.242, p = 0.045), and increasing seabed water temperatures (ρ = 0.288, p = 0.016). Distance from the edge of the Exuma Sound was a significant predictor for the presence or absence of Squalus cubensis, Mustelus canis insularis, Centrophorus spp., Hexanchus nakamurai and Centroscymnus owstoni. Furthermore, depth and temperature were significant predictors of the presence or absence of S. cubensis, M. canis insularis and C. owstoni. Depth was also a significant predictor of presence or absence of H. nakamurai. There were no predictable trends in the abundance of Hexanchus griseus, Galeus springeri or Pseudotriakis microdon. Significantly skewed sex and/or maturity ratios were identified for a number of species suggesting that this is a common life history trait in deep water elasmobranchs. The results of this study indicate that the use of deep water longline surveys in the Exuma Sound, and similar oceanographic areas, is an efficient and cost effective method for the sustained investigation of deep water elasmobranchs, and is vital for the effective management of this especially vulnerable group of species.
BURGESS, GEORGE; COELHO, RUI; SCHOFIELD, PAMELA. 2012.
(GB) Florida Program for Shark Research, Florida Museum of Natural History, Univ. Florida; (RC) Centre of Marine Sciences (CCMAR), Faro, Portugal; (PS) Southeast Ecological Science Center, US Geological Survey, Gainesville, FL, United States
Advances in the taxonomic resolution of the Etmopterus lucifer-complex in the Indo-Pacific region
Lantern sharks of the genus Etmopterus (Elasmobranchii: Etmopteridae) are deep-sea sharks characterized for producing visible light through epidermal photogenic organs (photophores). Within this group, the Etmopterus lucifer complex forms a species complex characterized for having the dermal denticles arranged in longitudinal rows. The worldwide distribution of this group and the morphological and coloration similarities, historically have resulted in difficulties in species identification. Adding to that, when captured from commercial fisheries this group of sharks is usually discarded due to their low to null commercial value, making the availability of study material limited. Our review of this complex revealed the presence of five morphs in the Australian region, including three undescribed species. The two previously described species, Etmopterus brachyurus (known from Western Australia) and Etmopterus molleri (New South Wales) are distinguished by their elongate bodies and photophore and pigmentary patterns. The three additional morphs newly described are provisionally referred to as ―finescale‖, ―dark‖ and ―rough‖. The undescribed ―finescale‖ (NSW and Queensland) is distinguished by its dense curved denticles, while those of both ―rough‖ (an undescribed Great Australian Bight species) and ―dark‖ (NSW and Tasmania) are more erect and set in well-spaced rows. ―Rough‖ and ―dark‖ morphs are separated by a series of morphological and denticle density characters. Ironically, Etmopterus lucifer, by literature attribution nominally cosmopolitan in distribution, is absent from Australia and seems to be confined to the NW Pacific, where it was originally described. This study represents and advance in the taxonomic resolution of this species-complex, that until recently has been poorly-studied. Such increased knowledge will allow for more detailed (species-specific) data to start being collected, which will contribute for a better management and conservation of this species group.
BURKHOLDER, DEREK; HEITHAUS, MICHAEL; FOURQUREAN, JAMES; WIRSING, AARON. 2012.
(DB) North Miami; (MH,JF) Florida International University, North Miami, FL, United States; (AW) University of Washington, Seattle, WA, United States
Top-down control in a relatively intact seagrass ecosystem
Coastal marine ecosystems have been degraded dramatically worldwide and continue to be threatened. Seagrass ecosystems, which provide critical habitat for juveniles of many species, including commerciall important ones, have been particularly hard-hit. Of particular interest is the loss of large herbivores (e.g. sea turtles and sirenians) and top predators (e.g. sharks), which may have disrupted top-down processes that were historically important. We used exclusion cages to elucidate the effects of large herbivores (green sea turtles, Chelonia mydas and dugongs, Dugong dugon) on seagrass community structure, nutrient dynamics, and ecosystem dynamics in the relatively pristine seagrass ecosystem of Shark Bay, Western Australia. We also investigated the possible indirect effect of top predators (tiger sharks, Galeocerdo cuvier) on seagrass beds mediated by spatiotemporal shifts in grazing by green turtles and dugongs. Excluding large grazers from mixed beds of Halodule uninervis, Cymodocea angustata, and Halophila ovalis for thirty-two months resulted in a shift in seagrass community composition, increased shoot lengths in all species and increased total seagrass biomass. However, seagrass responses to exclusion were species-specific. There were increases in percent cover and shoot density for Cymodocea angustata but a decrease in cover and density for both Halodule uninervis and Halophila ovalis. Overall, our findings suggest that spatiotemporal shifts in foraging habitat use by megagrazers may mediate indirect effects of tiger sharks on the seagrass communities of Shark Bay and that declines in these taxa in other parts of their range are likely to result in changes to seagrass communities.
CALICH, HANNAH; CAMPANA, STEVEN. 2012.
(HC) Dalhousie University; (SC) Bedford Institute of Oceanography, Dartmouth, NS, USA
Mating scars reveal mate size in blue sharks (Prionace glauca)
Blue sharks ( Prionace glauca ) are the most abundant large shark species in the Atlantic Ocean yet little is known about their reproductive habits. Male blue sharks engage in precopulatory biting, which produces mating scars on females. These scars are often observed on sexually immature females. The objective of this study was to determine the size and maturity status of male sharks attempting to mate with immature females. Using data collected from sharks caught at annual Nova Scotia shark fishing tournaments between 1993 and 2011, I found a significant curvilinear relationship between male shark fork length and jaw gape. By using the mating scar diameter as the independent variable, I was able to estimate the fork length and infer the sexual maturity of the male sharks that produced the mating scars. Results indicate that mature males with a mean fork length of 218 cm ± 24 cm were attempting to mate with sexually immature females However, there was no significant relationship between the estimated size of the male and that of the female with which it was trying to mate, indicating that male blue sharks do not have a size preference for mating. Based on the female fork lengths I suggest that the females should be classified as subadult instead of immature, making it possible that these females were capable of sperm storage and possibly self-fertilization.
CAMPANA, STEVEN; FISK, AARON; KLIMLEY, PETER. 2012.
(SC) Fisheries and Oceans Canada; (AF) Univ. of Windsor, Windsor, ON, Canada; (PK) University of California, Davis, Davis, CA, United States
Greenland sharks and their long distance migrations to nowhere
Archival satellite popup tags (n=16) were deployed on Greenland sharks (Somniosus microcephalus) up to 4.5 m in length, both in the Canadian Arctic and off the eastern coast of Canada. Despite their large size, most of the sharks were immature at the time of tagging. Tags remained on the sharks for an average of 6 months before popping off. All tagged sharks travelled a minimum of 150 km, and some as much as 1500 km, at depths of up to 1200 m. Migration pathways which took the sharks off the continental shelf, and well off the bottom, beg the question: what the heck are these sharks doing?
CARLISLE, AARON; GOLDMAN, KENNETH; BIGMAN, JENNIFER; MADIGAN, DANIEL; LITVIN, STEVEN; KLINE, THOMAS; BLOCK, BARBARA. 2012.
(AC,DM,SL,BB) Stanford University, USA; (KG) Alaska Department of Fish and Game, Canada; (JB) Moss Landing Marine Laboratories, USA; (TK) Prince William Sound Science Center, USA
Investigating Ontogenetic Changes in Habitat Use in Salmon Sharks Using Stable Isotope Analysis
Salmon sharks ( Lamna ditropis ) are wide-ranging apex predators in the North Pacific. As upper trophic level predators, they likely play an important role in structuring North Pacific marine foodwebs, yet virtually nothing is known about trophic ecology and habitat use of young salmon sharks or ontogenetic shifts in their diet and habitat use. We used stable isotope analysis (SIA) of salmon shark vertebrae to elucidate ontogenetic changes in habitat use and trophic ecology. The tissue in each annulus of a salmon shark‘s vertebra provides an isotopic record that reflects an integrated record of their movements and foraging over a year of their life. By serially sampling vertebral annuli for stable isotope ratios of carbon ( 13 C/ 12 C) and nitrogen ( 15 N/ 14 N) we reconstructed the general migratory history of individual sharks. We utilize an isoscape of the major biogeographic provinces of the eastern North Pacific in conjunction with a Bayesian mixing model to estimate annual patterns of use among ecoregions. There was a clear ontogenetic shift in habitat where sharks primarily used offshore habitats during their juvenile years, with increasing use of productive neritic habitats with age. Electronic tagging data was used to inform SIA results by characterizing annual patterns of ecoregion residence of larger sharks. Integrating electronic tag and stable isotope data provides a unique and powerful way to study the ecology and life history of these important and difficult to study predators.
CARLSON, AMY; SULIKOWSKI, JAMES. 2012.
University of New England, USA
Horizontal and Vertical Movement Patterns of Archival Satellite Tagged Spiny Dogfish (Squalus acanthias) in the Northwestern Atlantic
Spiny dogfish (Squalus acanthias) are assumed to be a highly migratory species, making habitual north- south migrations throughout their Northwestern Atlantic U.S range. Because spiny dogfish are also assumed to be a benthic species, their stock structure is estimated through bottom trawl surveys. Recent anomalies in population trends, including a recent four-fold increase in spawning stock biomass, suggest alternative movement behaviors may exist for this species. To obtain a better understanding of the horizontal and vertical movement dynamics of this species, Microwave Telemetry Pop-off Satellite Archival X-Tags have been attached to spiny dogfish at the northern extent of their U.S. geographic range. Ten adult male and thirteen adult female spiny dogfish fixed with these satellite tags were deployed in the Gulf of Maine, off the coast of Portland, Maine throughout 2007-2010. Twenty-two of the twenty-three tags have released and transmitted data. Of these twenty-three tags, three have been physically recovered, twenty-two have been filtered and modeled, and one failed to transmit. Approximate geolocations and vertical movements within the water column were derived from archival light level, pressure, and temperature records and has been filtered and fitted with bathymetric data using derivations of the kftrack modeling package in R and Matlab. Reconstructed tracks ranging in lengths from 2 to 12 months suggest that the seasonal migration patterns appear to be more regional (between the Gulf of Maine and New Jersey) and local (between the Gulf of Maine and Cape Cod) in nature. Kernel utilization distribution models also suggest strong core home ranges for these tagged individuals. In addition, vertical movements show distinct diel patterns with deepest recorded depths ranging from 70 to over 600 meters. Vertical preferences also suggest this species may not utilize the benthos as much as implied. Additionally, correlations to abiotic factors and overall sample-wide patterns suggest differences in movement patterns from older published migration paradigms. Based on this preliminary data, it appears that spiny dogfish populations estimated from NEFSC bottom trawl surveys may not be as indicative as once thought due to these new movement findings.
CARLSON, JOHN; SMITH, KELCEE; NORTON, SHELLEY; SIMPFENDORFER, COLIN. 2012.
(JC) NOAA NMFS Panama City Laboratory; (KS) National Marine Fisheries Service, Panama City, United States; (SN) National Marine Fisheries Service, Saint Petersburg, United States; (CS) James Cook University, Townsville, Q, Australia
Extinction risk and viability of sawfish populations
Sawfish (Family Pristidae) populations have been declining worldwide and currently are among the most endangered marine fishes. Data from multiple sources indicates many populations have undergone significant population declines and severe fragmentation. As such, the International Union for the Conservation of Nature (IUCN) lists all species of sawfish as ―Critically Endangered‖ on the IUCN Red List and the United States lists the US distinct population of smalltooth sawfish and globally the largetooth sawfish as Endangered under the Endangered Species Act. Despite these listings, there is little investigation on the existing populations in terms of their current risk of extinction, and potential viability and recovery. Given the lack of data for many populations, we determined the probability that local scale extinction have occurred using a time series of incidental observations, such as surveys, museum collections and records from the public. For existing populations, we applied a sensitivity analyses to suggest minimum probability levels for declaring a species to be in danger of local extinction. For all species examined, the highest probability of localized extinction occurred in West Africa and Central America with the lowest probability determined for Australia and the United States. Recognizing the model does not take into account important biological information (e.g. population increase rates), we determined quasi-extinction risks in a population viability model and found all populations had the potential to increase given fishing mortalities below 20%.
CARTAMIL, DANIEL; KOHIN, SUZANNE; SOSA-NISHIZAKI, OSCAR; SANTANA, OMAR; OLVERA, MIGUEL; GRAHAM, JEFFREY. 2012.
(DC,JG) Scripps Institution of Oceanography, USA; (KS) Southwest Fisheries Science Center, Canada; (OSN,OS,MO) CICESE, Canada
Satellite tagging of juvenile thresher sharks (Alopias vulpinus) in the Southern California Bight
The common thresher shark is a large, wide-ranging coastalpelagic species. In the eastern Pacific, it ranges from Baja California, Mexic oto British Columbia, Canada.Throughout its range it is harvested commercially, and it constitutes the largest shark fishery in California waters. Nevertheless, many aspects of its biology are poorly known, particularly as regards early life history. In the present study, juvenile thresher sharks (i.e., fork length < 120 cm) were tagged with pop-up satellite archival tags (Microwave Telemetry X-tags) to investigate their long-term movement patterns, habitat preferences, and geographic range. All sharks were tagged in southern California waters. Tag deployments ranged from three to six months, and tags archived light level, depth and temperature information. In total, data were successfully acquired from 23 juvenile threshers; eight tags were physically retrieved and produced high resolution archival data sets. 89% of pop-off locations were over the continental shelf. The furthest southward movement was to Bahia Sebastian Vizcaino, Baja California, Mexico, and the furthest northward movement offshore of Morro Bay California. Juvenile thresher sharks primarily inhabited the upper 60 m of the water column, and showed a strong diel depth distribution, with significantly greater depths by day. Results indicate that the nursery area of the common thresher in the eastern Pacific consists mainly of continental shelf waters from central Baja California, Mexico to central California, USA. In Mexican waters, juvenile threshers are harvested by the inshore artisanal gillnet fishery.
CASAS, ANDRÉ; INTELIZANO, WAGNER; CARVALHO, MARCELO. 2012.
(AC,MC) Universidade de São Paulo, Brazil; (WI) Universidade Metropolitana de Santos
Anatomical variation in the extrinsic eye muscles of the Odontaspidade (Chondrichthyes: Lamniformes).
The family Odontaspididae is represented by the genera Carcharias and Odontaspis and has been considered to be paraphyletic in morphological and molecular studies. These results suggest that odontaspidid morphology should be revised. The present study examined seven specimens of this family (six Carcharias taurus, one Odontaspis noronhai) and two specimens of Rhizoprionodonsp. (Carcharhiniformes), with the objective to describe and understand morphological variation in their extrinsic eye muscles. Carcharias taurus and Odontaspis noronhai present six extrinsic eyes muscles (rectus dorsalis, rectus lateralis, rectus ventralis, rectus medialis, obliquus dorsalis, and obliquus ventralis), therefore resembling the elasmobranch general pattern. To precisely determine the morphology of the obliquus dorsalis muscle in the examined species the trochlear nerve (IV) was followed from its origin to its distal innervation. This procedure revealed variations in the origin of the obliquus dorsalis when compared to the general pattern described for other elasmobranchs. Two distinct conditions for its origin were found: state (0), origin on nasal capsule dorsal to the origin of the obliquus ventralis (present in Odontaspis noronhai, Alopidae, Lamnidae and in the great majority of elasmobranchs described in the literature); and state (1), origin on nasal capsule ventral to the origin of the obliquus ventralis (present in Carcharias taurus and Rhizoprionodon sp.). This preliminary result suggests that state (1) is independently derived in Carcharias taurus and Rhizoprionodon sp. For a greater comprehension of the phylogenetic meaning of the variation in the obliquus dorsalis in Carcharias taurus, additional lamniform and other elasmobranch taxa must be examined.
CHARVET, PATRICIA; VIANA, ANDERSON. 2012.
(PC) SENAI / PR; (AV) Projeto Trygon
Embryonic Stages of Development of Neotropical Freshwater Stingrays (Potamotrygonidae)
Neotropical freshwater stingrays are highly valued as ornamental fish and the trade is concentrated on neonate and juvenile specimens due to size issues. Despite having these after birth life stages well known, little information is available on the embryonic development of potamotrygonids. In the present study over 500 embryos of potamotrygonid species (mainly Plesiotrygon iwamae, Paratrygon aiereba, Heliotrygon rosai, Potamotrygon leopoldi, P. scobina, P. motoro, P. orbignyi and P. signata ) were macroscopically analyzed, weighted and measured. Five main stages of development were noted, each with specific morphological characteristics such as disc and pectoral fins formation, gills development, pigmentation, disc width size, weight and yolk sac proportion. The results were consistent for all species studies until now and a specific embryonic development scale is presented for this group. Some of the main features for each stage are presented as follows. At the first stage gills are external, pectoral fins not fused, there is no sign of pigmentation and the yolk sac weight corresponds to approximately 90% of the embryo weight. The second stage has similar features, however, pectoral fins are fused and yolk sac decreases to around 60% of the embryo weight. At the third stage gills become internal and the yolk sac corresponds to less than 50% of the embryo weight. The most significant changes at stage four comprise beginning of the pigmentation process and a significant reduction on the yolk sac proportion, corresponding now to around 15% of the embryo weight. The fifth and last stage of development is widely known as near term embryonic development, when pectoral fins are fully developed, gills are internal, pigmentation patterns are well defined and the yolk sac proportion drops down to less than 5% of the embryo weight. In some regions of the Amazon basin where ornamental captures are carried out illegally, some fishermen capture pregnant females, cause abortions and try to commercialize embryos at stages of development four or five. This condemned practice leads to embryo mortality in most cases, since only occasionally embryos at stage five might survive if aborted. The existence of an embryo development scale for this group of stingrays contributes to determine pregnancy development and provides data for law enforcement agents to detect when illegally aborted embryos are tentatively being commercialized.
CHURCHILL, DIANA; HEITHAUS, MICHAEL R.; GRUBBS, DEAN; VAUDO, JEREMY. 2012.
(DC,MRH,JV) Florida International University, North Miami, FL, United States; (DG) Florida State University, St. Teresa, FL, United States
Effects of the Deepwater Horizon Spill on the trophic interactions of deep-sea sharks and associated species of the Gulf of Mexico.
The Deepwater Horizon oil spill (DwH) was significant not only in the amount of oil, but also the depth of the release and the unprecedented subsurface use of dispersants. Therefore, the benthic contaminants from the spill may have had significant impacts on the poorly characterized deep-sea communities of the northern slope of the Gulf of Mexico (NGS). We explored the potential impacts of the DwH on deep sea food webs by comparing trophic interactions of upper level predators (sharks, teleosts) and benthic scavengers (crabs, giant isopods, hagfish) from sites located in close proximity to the spill site (NGS) and sites at similar depths located 400 km from the spill along the west Florida slope (WFS). We also took advantage of samples from the WFS sites collected prior to the spill to investigate temporal variation in trophic interactions of representative species. We assessed trophic interactions using a combination of stomach contents and stable isotope (δ13C and δ15N) analysis. Stomach contents analysis revealed the diet of Cuban dogfish (Squalus cubensis), the numerically dominant elasmobranch, to be composed of shrimp, cephalopods and mesopelagic fishes, with slight variation in their relative contributions to diets in the NGS and WFS sites. Cuban dogfish δ13C isotope values varied slightly between the NGS and WFS sites. In general across all species, there was little interspecific variation in isotopic values within and between sites. These results, however, are based on the first of a series of sampling events after DwH and because of likely slow isotopic turnover rates in deep-sea organisms may not yet reflect potential changes in trophic structure after the spill.
CLARKE, TAYLER; ESPINOZA MENDIOLA, MARIO; VILLALOBOS, FRESIA; WEHRTMANN, INGO. 2012.
(TC) University of Costa Rica; (MEM) James Cook University; (FV,IW) Unidad de Investigación Pesquera y Acuicultura, Universidad de Costa Rica
Reproductive ecology of four elasmobranch species in the Pacific coast of Costa Rica, Central America
Sharks and rays are a common component of the bycatch in many tropical demersal trawling fisheries. The elasmobranch bycatch of the commercial shrimp trawling fishery operating along the Pacific coast of Costa Rica is comprised by a total of 24 species. In data deficient fisheries such as this one, life history may be used as a valuable tool to identify vulnerable species and apply precautionary measures that could ensure their long-term conservation. Therefore, we studied the reproductive ecology of Raja velezi, Mustelus henlei, Zapteryx xyster and Torpedo peruana associated to the commercial deepwater shrimp fishery along the Pacific coast of Costa Rica. This information was used to identify essential habitats and recommend management measures for elasmobranchs in Costa Rica. A total of 217 tows were carried out at 25-350 m from March 2010 to September 2011. During this period, a total of 751 individuals of R. velezi , 569 M. henlei , 394 Z. xyster and 157 T. peruana were obtained. The size at sexual maturity was estimated as: 52-56 cm TL for R. velezi , 39-43 cm TL for M. henlei , 45-47 cm LT for Z. xyster and 54-65 cm LT for T. peruana . Fecundity increased with female length. M. henlei presented between 1 and 12 embryos, and Z. xyster carried between 1 and 9 embryos. Segregation by size and sex was detected in all species, mainly related to depth. Most gravid females were found at depths >50 m along the Pacific coast. However, some areas such as the Golfo de Nicoya, the Quepos-Manuel Antonio wetlands and the Humedal Nacional Térraba-Sierpe (HNTS) presented large aggregations of gravid females and immature individuals. We recommend the protection of these critical habitats and the creation of discrete fishing closures at depths 50 m along the Pacific coast of Costa Rica.
COELHO, RUI; ERZINI, KARIM. 2012.
(RC) Centre of Marine Sciences (CCMAR); (KE) Centro de Ciências do Mar (CCMAR), Faro, Portugal
Demographic analysis of the velvet belly lantern shark, Etmopterus spinax, caught and discarded by trawl fisheries in southern Portugal (NE Atlantic)
The velvet belly lantern shark, Etmopterus spinax, is a deep-sea shark usually caught as by-catch and discarded in deep water commercial fisheries in southern Portugal, particularly deep water trawls and longlines. The objective of this study was to determine demographic parameters for this species, in order to determine how the current levels of fishing mortality are affecting this population. Mortality and survivorship parameters were estimated both by indirect empirical methods from life history parameters, and from the trawl fisheries catch curves. An age-structured demographic model was created, and analyzed with Leslie matrices, considering scenarios with and without taking into account fishing mortality. The analysis was carried out using both deterministic scenarios (considering the point estimates), and with scenarios taking into account the uncertainty in the parameter estimation (using random errors according to specific distributions). The stochastic scenarios were simulated by Monte Carlo simulation, with each input parameter randomly generated based on the previously assumed distributions. In general, when only natural mortality was considered, the population rate of increase was usually higher than 1. In the scenarios considering total mortality from the trawl fisheries catch curves, the population rates of increase were usually lower than 1, meaning that the population in those cases is declining. Matrix elasticities were calculated. For the survivorship parameters, the elasticities were higher for the younger age classes and tended to decrease for the older ages, which is typical of the slower growing elasmobranch species. The results presented in this paper provide insights on how commercial fisheries, particularly trawls, are affecting this deep water shark species, and how uncertainty in the life history parameters can affect the demographic models estimations.
COELHO, RUI; FERNANDEZ-CARVALHO, JOANA; SANTOS, MIGUEL. 2012.
(RC) Centre of Marine Sciences (CCMAR); (JCF,MS) Instituto Nacional de Recursos Biológicos (INRB, I.P./ IPIMAR), Olhão, Portugal
Hooking mortality of elasmobranchs caught in a swordfish pelagic longline fishery in the Atlantic Ocean.
Hooking (at-haulback) fishing mortality of elasmobranchs captured by Portuguese longliners targeting swordfish in the Atlantic Ocean was analyzed. Information was collected by on-board fishery observers that monitored 834 longline fishing sets between August 2008 and December 2011, and recorded information on 36,067 elasmobranch specimens from 21 taxa. The hooking mortality proportions are species-specific, with some species having relatively high percentages of alive specimens at-haulback (e.g. blue shark, crocodile shark, pelagic stingray, manta, devil and eagle rays), while others have higher percentages of dead specimens (e.g smooth hammerhead, silky shark, bigeye thresher). Specimen size is a significant covariate for calculating the odds-ratios of hooking mortality for the blue, the crocodile shark and the shortfin mako, with larger specimens having lower odds of being dead at-haulback. For the blue shark, a multivariate Generalized Linear Model was calculated, and the factors affecting at-haulback mortality were specimen size, geographical coordinates (latitude and longitude), year, quarter of the year, vessel, and branch line material. To assess possible dependency in the binomial response variable (dead or alive at-haulback), a Generalized Estimation Equation model was calculated using each longline set as the grouping variable. The correlation parameter in the GEE model was low, and the parameters estimated with the GEE were similar to the GLM. The results presented in this paper provide new information on the hooking mortality of elasmobranchs captured as by-catch in this pelagic longline fishery, and can be integrated in future ecological risk assessment analysis for pelagic elasmobranchs. Additionally, these results also provide new information on the efficiency of the recent recommendations for the mandatory discards of some vulnerable elasmobranch species mandated by ICCAT.
CORKE, JARRETT; WIMMER, TONYA. 2012.
(JC,TW) WWF-Canada, Halifax, NS, Canada
Bycatch and unaccountable discard mortality in fishing operations are the primary threat to elasmobranchs in Atlantic Canada. Pelagic and groundfish longline, mid-water and bottom trawl fisheries account for the largest proportion of shark bycatch. Enhanced data collection is needed to accurately estimate bycatch mortality, but additional important information on non-target species catches in commercial fisheries can be accessed by direct communication with fishermen. To gather this knowledge for WWF-Canada, qualitative interviews were conducted with pelagic and groundfish longline captains. The objectives were to: 1) through a mapping exercise, determine spatial and temporal distributions of elasmobranchs and identify potential bycatch hotspots; 2) identify modifications to fishing practices employed by fishers in response to elasmobranch interactions; 3) identify methods to reduce and/or avoid bycatch; and 4) describe fishers‘ attitudes and perceptions towards elasmobranchs and the bycatch of these species.
This study will be completed by the summer of 2012. Results thus far indicate that fishermen have a considerable knowledge of elasmobranchs. Blue sharks (Prionace glauca) were the elasmobranch species most commonly caught in both pelagic and groundfish longline fisheries. Fishermen reported a significant change in both the size and age blue sharks they caught over the past decade, potentially indicating shifts in overall population structure of this species in the NW Atlantic. A mapping exercise has also revealed the spatial and temporal distributions of areas where certain bycaught species are consistently encountered (e.g. Portuguese dogfish, Centroscymnus coelolepis).
Significant conservation benefits can be obtained from fishers‘ knowledge, which can provide a real-time perspective of the current circumstances on the water. Through integration of scientific literature with the study results, a more comprehensive perspective may emerge on the elasmobranch bycatch problem in Atlantic Canada. Furthermore, results may inform the future direction of management objectives to further elasmobranch conservation in Atlantic Canada.
COSANDEY-GODIN, AURELIE; WIMMER, TONYA; JOHN H., WANG; WORM, BORIS. 2012.
(ACG,BW) Dalhousie University, Halifax, NS, Canada; (TW) WWF-Canada, Halifax, NS, Canada; (JHW) NOAA-Kewalo Research Facility, Honolulu, HI, United States
No Effect from Rare-Earth Metal Deterrent on Shark Bycatch in a Commercial Pelagic Longline Trial
The indiscriminate capture of non-target organisms (bycatch) in commercial fisheries is an issue of critical concern to the sustainable development and conservation of marine resources. In the Northwest Atlantic, blue sharks ( Prionace glauca ) comprise a significant proportion of unwanted bycatch in the Canadian pelagic longline fleet targeting swordfish and occasionally tuna. Minimizing the capture of these species is of interest to the industry as well as conservation organizations. Several shark species have been shown to be repulsed by the magnetic field generated by rare-earth magnets. For this reason, magnetic deterrents have become a promising bycatch solution on pelagic longlines, but controlled trials under commercial fishing conditions are still lacking. In collaboration with the longline industry, a total of 7 sets (6300 hooks) with three hook treatments: standard hooks, hooks equipped with rare-earth alloys (Nd/Pr), and hooks with lead weights were deployed in 2011 on the outer scotia Shelf, Nova Scotia. Results suggest that rare-earth metals do not have any significant deterrent effect on the most common shark bycatch species (blue, mako, and porbeagle) and as such are not a practical bycatch mitigation option in the Canadian fishery. The inclusion of all stakeholders in this study has proven valuable in improving the methodology by operating under realistic commercial-scale conditions; we believe that this is an effective way to conduct bycatch research at a regional level.
COTTON, CHARLES; GRUBBS, DEAN. 2012.
(CC) Virginia Institute of Marine Science; (DG) Florida State University, USA
Biology of Deep-water Chondrichthyans: Introduction
Approximately half of the known chondrichthyans, nearly 600 species, live in the deep ocean (below 200 m), yet little is known of the biology or life history of most of these fishes. The limited information about deep-water chondrichthyans is often confounded by uncertainty in the taxonomy and systematics of these taxa and new species are frequently described. Research is also hindered because many species are known from few specimens of only the type material. The need for more research and dissemination of information about deep-water chondrichthyans has become more urgent as fisheries worldwide expand deeper. Until recently, much of the fishing effort on deep-water chondrichthyans was localized and often artisanal. However, contemporary fishing effort for deep-water sharks has been increasing worldwide, in spite of considerable data indicating that deep-water fishes have among the slowest of vertebrate life histories (slower growth, delayed maturity, lower fecundity). K -selected life histories render these deep- water species susceptible to overexploitation and localized depletion, yet most exploitation occurs in the absence of the species-specific life history or biological information needed to develop management plans. This symposium will provide a forum for the dissemination of the extensive volume of new information available on this unique group of fishes, including data that may inform management plans and conservation efforts. It will also facilitate the formation of networks of deep-water chondrichthyan researchers working within the sub-disciplines of taxonomy, telemetry, feeding and trophic dynamics, age and growth, biogeography, physiology, reproductive biology, and population genetics.
COTTON, CHARLES; GRUBBS, DEAN; MUSICK, JOHN. 2012.
(CC,JM) Virginia Institute of Marine Science, Gloucester Point, VA, United States; (DG) Florida State University Coastal and Marine Laboratory, St. Teresa, FL, United States
Reproduction and embryonic development in two species of North Atlantic squaliform sharks, Centrophorus cf. niaukang and Etmopterus princeps: evidence of matrotrophy?
Chondrichthyans ovulate much larger eggs and undergo a more protracted embryonic development than bony fishes. As a result, some organic matter originally present in the chondrichthyan egg yolk is depleted via metabolic excretion over the course of embryogenesis. Previous studies have suggested that the energetic toll of embryogenesis in lecithotrophic species depletes organic matter in the egg by more than 20% during embryonic development. Conversely, organic matter in developing embryos of matrotrophic species is augmented by various forms of maternal nourishment, resulting in organic matter depletion of less than 20% during embryogenesis. We compared the mass of organic material in freshly fertilized eggs to that of near-term embryos to investigate the maternal-embryonic nutritional relationships of Centrophorus cf. niaukang and Etmopterus princeps collected from the North Atlantic. Measurements of ash-free dry weights of a series of embryos revealed that some form of maternal nutrient contribution, likely mucoid histotrophy, occurs in at least one species. Centrophorus cf. niaukang embryos undergo a reduction of 19.5% in organic matter, while E. princeps embryos undergo a reduction of 7.8% in organic matter over the course of embryonic development. Uterine villi were present in both species and became larger and increasingly vascularized over the course of gestation. Though previous studies have suggested a strictly respiratory and ionic exchange function in similar species, the aggregate role of these uterine villi is not fully understood and they likely produce mucoid histotroph in the species we examined. Embryos of C . cf. niaukang were also dissected in order to track the partitioning of water, organic matter, and inorganic matter to the liver, external yolk sac, internal yolk sac, digestive tract, and eviscerated body, throughout development. Observed fecundity and maturity ogives are also presented along with comments on the apparent aseasonality of mating and the ovarian cycle of each species. Likewise, we present the observed patterns of segregation by sex and reproductive stage for each species. Our results are compared with previous studies of reproductive biology and maternal- embryonic nutritional relationships of other chondrichthyans.
DAVIDSON, LINDSAY; DULVY, NICHOLAS; FORDHAM, SONJA. 2012.
(LD,ND) Simon Fraser University, Canada; (FS) Shark Advocates International
How much of the world’s shark fishing is sustainable?
Unregulated catches of sharks and rays (hereafter ―sharks‖) for their fins and meat are driving population declines and elevating extinction risk. Demand for shark products has increased sharply since the 1980s and remains strong, not only for shark fin, but also meat from previously undesirable species such as blue shark. Implementation of management measures to control this rapidly rising mortality have been sluggish and existing restrictions lack consistency across species‘ ranges. Here we ask what proportion of the world‘s chondrichthyan catch is likely to be sustainable. We make the pragmatic and to-be-tested assumption that countries with adequate shark plans are fishing sustainably. In order to identify hotspots of conservation action and requirement, we describe the nation-by-nation spatial distribution of chondrichthyan biodiversity patterns, catch levels, shark fin exports, and strength of shark plan. We found that less than half of the top 20 sharks fishing nations with the greatest reported catch have yet to implement a shark plan, and a quarter have yet to implement some form of shark finning ban. Moreover, hotspots of shark biodiversity occur in national waters with high fishing mortality of sharks and low levels of shark fisheries management.
DAVIS, BRENDAL; WORM, BORIS. 2012.
(BD,WB) Dalhousie University, Canada
The International Plan of Action for Sharks: How does Canada¿s national plan measure up?
Various species of sharks, skates, and rays continue to decline, demonstrating a greater need for effective conservation measures. In 1999 the Food and Agriculture Organization (FAO) developed comprehensive guidelines in its International Plan of Action (IPOA- sharks ), which was followed by corresponding national plans in some nations. Here we examine progress under Canada‘s National Plan of Action for Sharks (NPOA- sharks ), against its stated goals, against Australia‘s NPOA, and against the original FAO guidelines. For comprehensiveness, we also evaluate additional management and conservation measures for sharks, as well as stakeholder input from the first Atlantic Shark Forum. Although Canada is recognized as a leader in shark management, it has largely failed to effectively adopt the FAOs principles and guidelines. The plan notably lacks set timelines, priorities, or action plans to mitigate threats to sharks, and contains no performance indicators. Additionally, the plan neglects to identify priority species, or engage stakeholders, and cannot be linked directly to management measures. To advance the revision of this plan (as well as other NPOAs), we recommend a stepwise process that includes (i) stakeholder engagement and development of a shark assessment report (SAR) (ii) addressing of all IPOA objectives, while prioritizing issues arising from the SAR (iii) implementations of actions, targets, and timelines that are reviewed every four years. We also suggest key policy items to advance Canada‘s role in shark conservation and management at the national and regional level. These include actions to improve data collection and research, management, education, as well as coordination with stakeholders. If Canada aims to improve shark management and conservation, major changes are needed to the existing NPOA. Likewise, the abovementioned measures may help guide more proactive plans in nations that have not yet established an NPOA.
DELL’APA, ANDREA; CUDNEY-BURCH, JENNIFER; RULIFSON, ROGER. 2012.
(AD,JCB,RR) East Carolina University, Greenville, NC, United States
Male:Female Ratio Changes In Spiny Dogfish (Squalus acanthias) Fishery-Dependent Surveys In Cape Cod, MA: Fishery Management Aspects
The international exploitation of the sexually dimorphic spiny dogfish (Squalus acanthias) is driven by the European market, which demands for large females. This sex-selective fishery led to over-exploitation of the US Atlantic stock, forcing the adoption of a Fishery Management Plan (FMP) to rebuild it. The species biological characteristics (long gestation period, slow growth rate), and the targeting of adult females, raise concern on the conservation status of dogfish worldwide, leading to the discussion for inserting the species in the CITES‘s list for regulating the trade. In case of listing, a fishery must provide for its sustainability in order for the stock to be commercialized. The sustainability of the US Atlantic dogfish stock is measured based on the biomass of adult females. Given the decrease in adult females reported for this stock over the last decade, alternative management strategies to enhance the fishery sustainability are needed. One possibility currently unexplored would be the development of a male-only directed fishery. The aim of this research is to test for significance in the male:female ratio changes in commercial surveys conducted in the Cape Cod, MA area, where local fishers observe higher abundance of males early in the day and higher presence of females as the day progresses. Results suggest the possibility for a male-only directed longline fishery within 10 miles off the coast of the Cape Cod Peninsula, where higher presence of schools of males occur in shallower water early in the day and at different fishing seasons. These results also support the employment of standardized research effort in the study area to monitor fine-scale behavior patterns of males through day and season in order to characterize male dogfish movements and to assess whether a male-only directed fishery in the area is viable
DRYMON, MARCUS; POWERS, SEAN; KROETZ, ANDREA; KEVIN, FELDHEIM; GAUTREAUX, JILL; MOORE, FRANK. 2012.
(MD,SP,AK) Dauphin Island Sea Lab, AL, USA; (KF) Field Museum, USA; (JG,FM) University of Southern Mississippi, USA
Are tiger sharks a seasonal conduit of terrestrial energy into marine foodwebs?
As apex predators, some shark species have the potential to couple energy pathways from disparate foodwebs. This is particularly true of tiger sharks, highly migratory fish known for the breadth of items they consume. In addition to foraging on invertebrates, bony and cartilaginous fishes, sea snakes, marine mammals and seabirds, tiger sharks are known to consume terrestrial birds. While accounts of this predator-prey interaction date back over half a century, we know little about the pervasiveness of this phenomenon within a population, or of the potential contribution terrestrial birds make to the diet of tiger sharks. We investigated the extent to which individual tiger sharks are dietary generalists or specialists using a combination of stomach content and stable isotope analyses. Tiger sharks were sampled during routine, standardized bottom longline surveys of the coast of Alabama from 2009-2011. From fall 2010 to fall 2011, stomachs (n=48) and muscle tissue (n=52) were collected. Gut contents were identified to the lowest possible taxon, and avian remains (primarily feathers) were genetically identified. Three metrics were calculated from gut content data: the Shannon index, individual specialization and mean niche width. Individual isotope variation was used to compare to individual gut content variation. By using this combination of techniques, in concert with time series data from a standardized coastal bird survey, we combine datasets across marine and terrestrial ecosystems to evaluate the frequency of specialized feeding behavior in a known generalist shark. While tiger shark populations consume a notoriously wide range of items, identifying the extent that trophic strategy varies among individuals is increasingly important in the face of management measures that may impact only portions of the population (e.g. the recent harvest ban in Florida).
ESPINOZA, MARIO; CLARKE, TAYLER; VILLALOBOS-ROJAS, FRESIA; WEHRTMANN, INGO. 2012.
(ME,TC,FVR,IW) Universidad de Costa Rica – CIMAR
Dietary overlap and resource partitioning of four elasmobranch species off the Pacific of Costa Rica: implications for management
Sharks and rays are believed to play a significant role as top predators in aquatic food-webs, and presumably their removal can have significant ecological consequences. Twenty-five elasmobranch species are captured as by-catch in the commercial trawling fishery off the Pacific coast of Costa Rica, which accounts for over 36% of its elasmobranch diversity. At the moment Costa Rica lacks of adequate landing statistics, species-specific catch data and basic biological information on demersal elasmobranchs. Therefore, a better understanding of the distribution, diet composition, and ontogenetic shifts of common demersal elasmobranch species was used 1) to assess the degree of dietary overlap between species, 2) to identify feeding habitats and 3) to generate management strategies. A total of 1174 stomachs from four elasmobranch species were analyzed: Raja velezi (N = 512; 86% full), Mustelus henlei (N = 333; 83% full), Zapteryx xyster (N = 234; 80% full) and Torpedo peruana (N = 95; 58% full). Decapods were the most important prey item in immature R. velezi , M. henlei and Z. xyster , particularly in the Central Pacific region, while teleost fishes and stomatopods were more abundant in adults captured in the North Pacific. All life-stages of T. peruana fed primarily on teleost fishes along the entire Pacific coast. Dietary overlap was typically high between R. velezi and Z. xyster, with little overlap between M. henlei and T. peruana. The relative importance of crustaceans in the diet of elasmobranch species captured in the Central Pacific region suggest that shallow coastal habitats may be important for early stages. Additionally, differences in patterns of habitat use and ontogenetic dietary shifts may be reducing intra and inter-specific competition for resources. Management and conservation strategies for elasmobranch species associated to trawling fisheries in Costa Rica should focus on reducing by-catch rates and fishing effort in shallow coastal waters, particularly in the Central Pacific region.
FARRUGIA, THOMAS; SEITZ, ANDREW. 2012.
(TF,AS) University of Alaska Fairbanks, Fairbanks, AK, United States
Movement patterns of skates in the Gulf of Alaska and implications for the management of a skate fishery
Skates are in growing demand worldwide, specifically in European and Asian markets. As part of supplying this demand, the U.S. landings of skates in 2008, mainly from the Atlantic Ocean, was estimated at 65 million pounds, worth US$11 million. However, several Atlantic Ocean skate stocks are declining. In contrast, Alaska has relatively healthy skate stocks but skates can only be retained as non- target catch in federal and state waters of Alaska. Big skates ( Raja binoculata ) are the most frequently landed skate in the Gulf of Alaska and are managed by two management agencies, that each divide the skate non-target catch quota into multiple management areas and assume that big skates do not move among these areas. If a directed skate fishery is to be developed, more ecological data such as movement patterns and habitat use need to be explored. We deployed pop-up archival transmitting (PAT) tags on seven big skates in Prince William Sound, Alaska in July 2011 and set them to pop up in May and June 2012. This was the first instance of an electronic tag being deployed on any skate species in the Pacific Ocean and provided novel data on the movement patterns, temperature and depth utilization of big skates. It also provided a fishery-independent estimate of the connectivity of big skates between management areas. Ecological data such as these are crucial when managing a novel fishery, and are necessary when employing increasingly popular ecosystem-based management.
FERNANDEZ DE CARVALHO, JOANA; COELHO, RUI; NEVES DOS SANTOS, MIGUEL; ERZINI, KARIM. 2012.
(JFC) Center of Marine Sciences (CCMAR); (RC,KE) CCMAR, Faro, Portugal; (MNS) IPIMAR, Olhão, Portugal
Life history of the bigeye thresher shark, Alopias superciliosus, in the Tropical Eastern Atlantic Ocean
The bigeye thresher, Alopias supercilious, is commonly by-catch in pelagic longline fisheries targeting tunas and swordfish. Still, very little information is available for this species‘ life history in the Atlantic Ocean. As part of the EU Data Collection Regulation framework, Portuguese fishery observers have been placed aboard fishing vessels collecting information on captures, size, sex, maturity stage, and biological samples such as vertebrae. A total of 760 bigeye threshers were recorded between 2008 and February 2011, throughout the Atlantic. In the NE Atlantic, almost all size classes were observed and there was a higher proportion of females (65.08%). In the SE Atlantic, larger specimens were found and the presence of males (56.12%) was higher than females. Vertebrae of 356 bigeye threshers were collected and analysed so far. These were collected along a wide geographical range (between 18oN and 28oS), mostly along the East Atlantic, with size of specimens ranging from 101 to 265 cm fork length (FL). Preliminary trials were carried out to determine the most efficient band enhancement technique for this species, in which crystal violet section staining was found to be the best methodology. A linear relationship between specimen size and vertebrae diameter was found and observed vertebrae showed 1 to 22 pairs of opaque and hyaline bands. Preliminary growth models based on the Von Bertalanffy growth function (VBGF) and the VBGF with fixed size at birth were calculated and the parameters are presented and discussed. Maturity ogives were fitted for 402 specimens that had maturity data available, and size at first maturity was estimated at 206.1 cm FL for females and 159.7 cm FL for males. The results presented in this paper can be used and integrated in future ecological risk analysis and stock assessment models for this species in the Atlantic Ocean.
FERREIRA, LUCIANA; AFONSO, ANDRÉ; CASTILHO, PEDRO; HAZIN, FÁBIO. 2012.
(LF,AA,FH) UFRPE, Recife, Brazil; (PC) UFRPE, Serra Talhada, Brazil
Habitat use of the nurse shark, Ginglymostoma cirratum, off Recife, Northeast Brazil: a combined survey with longline and acoustic telemetry
Despite the high abundance of nurse sharks Ginglymostomas cirratum in shallow waters, knowledge on its ecology is still rather limited, with most studies restricted to the Caribbean and Florida coast. This study presents results on the relative abundance, sex ratio, size distribution, seasonal fluctuations and residency of the nurse shark, off Recife, northeast Brazil. Nurse sharks comprised 13.3% of the total catch of 1033 bottom longline sets, done from 2004 to 2011, and ranged in size from 107 to 300 cm TL. 98 sharks were tagged with an 8% recapture rate. The overall sex ratio for nurse sharks was 1.3♀:1♂, however, it showed a strong variation throughout the year. The monthly CPUE of male nurse sharks showed a somewhat more seasonal trend than females. Male CPUE tended to be lower ( 0.02) from October to April (except for December). Although female CPUE oscillated within a range similar to that of males, it showed no clear seasonal pattern. Of 8 acoustically tagged sharks, 6 were detected by the array of acoustic receivers. Most detection of males were recorded during the first semester of the year, peaking in February and March with zero detection from May to September. Females, in turn, were detected throughout the year, although most detection happened in the second semester, peaking in September. The results indicate that nurse sharks have a year-round occurrence in the study area and remain in the monitored area for variable periods of time. The strong seasonal shifts in the sex ratio of catches and the patterns revealed by the acoustic detections also suggest a possible difference in habitat usage or in seasonal movements between sexes, which hadn‘t been described so far for the Brazilian coast and may have serious implications for the management and conservation of nurse sharks at Northeast Brazil.
FERRY, LARA. 2012.
Arizona State University West
Elasmobranchs in Biological Research
Elasmobranchs get a lot of attention both within and beyond the scientific realm due to their fascinating, and sometimes terrifying, habits. This high profile has, in many cases, overshadowed some of the most amazing insights that have come from the study of this group. Such studies have taught us not only about the cartilaginous fishes, but also have given us novel insights into the most important and difficult to penetrate areas of biology. These advances could not have been made with the use of any other study system. This presentation will highlight several recent advances that should serve as inspiration for biologists interested in exploring fundamental biological questions. Among the exemplar projects that I will highlight are what shark and ray brains have to tell us about the evolution and function central nervous systems, what can be learned of sensory hierarchy from blacktip sharks, how stingrays crushing hard prey has inspired new biomaterials, and how the shark immune system and is teaching us about our inherent ability to recognize self and non-self.
FORD, RYAN; GELSLEICHTER, JAMES; FRAZIER, BRYAN; BELCHER, CAROLYN; PIERCY, ANDREW; GRUBBS, R. DEAN. 2012.
(RF,JG,PA) University of North Florida, USA; (BF) South Carolina Department of Natural Resources, USA; (CB) Georgia Department of Natural Resources, USA; (RDG) Florida State University Coastal Marine Lab, USA
Reproductive Periodicity of the Blacknose Shark (Carcharhinus acronotus) within its Atlantic Range
The blacknose shark ( Carcharhinus acronotus ) is a common small coastal shark species found in nearshore waters along the southeast coast of the United States, from North Carolina into the Gulf of Mexico and extending further south into the Bahamas. There has been some debate in recent years over the reproductive periodicity of C. acronotus in waters off the U.S. coast. Earlier studies have suggested that Gulf C. acronotus reproduce on an annual basis whereas the Atlantic populations of this species may reproduce biennially. The goal of the present study was to re-evaluate the reproductive periodicity of the Atlantic populations of C. acronotus with the intent on clarifying these differences. This was accomplished by examining male and female reproductive tracts in animals caught via fishery dependant and fishery independent gillnet and longline surveys conducted throughout the Atlantic range of C. acronotus. Based on these data, spermatogenesis appears to occur between late May to early July with peak sperm production occurring in June and July. In females, follicular development is likely complete by late June-early July with ovulation occurring shortly afterwards. Mating appears to occur between mid- June and early July based on the presence of fresh mating scars on females captured during this time. Current data suggests that gestation begins late July with parturition occurring late May to early June the following year. As observed in earlier studies, reproductive periodicity appears to be largely biennial. However, evidence for concurrent follicular development and pregnancy was observed in several females, suggesting that at least a portion of the Atlantic population may reproduce on an annual basis.
FRAZIER, BRYAN. 2012.
South Carolina Department of Natural Resources
Age and Growth of the Bonnethead, Sphyrna tiburo, in the Coastal Atlantic Waters off the Southeastern United States
The bonnethead is a relatively small shark, reaching a maximum length of 150 cm. It occurs in the western Atlantic Ocean from North Carolina to Southern Brazil, including the Gulf of Mexico (Compagno 1984). The bonnethead is placentally viviparous and unique among coastal sharks in the region, as its gestation period lasts for only five months and parturition occurs in the early fall. Life history characteristics have been well studied in the Gulf of Mexico, where maximum ages for males and females are 8+ and 12+ years, respectively (Parsons, 1993; Carlson and Parsons 1997). By contrast, comparatively little is known about bonnetheads in the Atlantic waters off the southeastern United States, although recent survey data suggests that their life history could differ from Gulf of Mexico bonnetheads. In South Carolina, where the majority of specimens were collected, bonnetheads are seasonally present and females primarily inhabit estuarine waters while males primarily inhabit shallow coastal waters. The objectives of this study were to (i) validate the periodicity of vertebral band pair formation in the Atlantic waters off the southeastern United States, (ii) characterize the age and growth of the bonnethead in the region, and (iii) investigate whether clinal variations in growth exists. Data from previous works were utilized to compare growth parameters determined during the current study with those conducted in other areas. Within population variation between northern and southern Atlantic specimens were also examined. A variety of growth models were fitted to age and size data and also compared against observed individual growth from tag-recaptures in order to determine the model that best fit the population. These data were used to generate regionally specific information on growth, maximum observed age, theoretical maximum age, and theoretical maximum length. This study contributes to the biological knowledge of this species and provides parameters that are essential for stock assessment purposes.
FURUMITSU, KEISUKE; KUME, GEN; YAMAGUCHI, ATSUKO. 2012.
(KF,GK,AY) Nagasaki University, Nagasaki, 3, Japan
The importance of the innermost area of Ariake Bay, Japan as the nursery ground for elasmobranchs
Coastal shallow areas such as estuaries and mangrove swamps have been widely recognized to function as ideal nursery grounds for many elasmobranchs. The study area, Ariake Bay, is located in the west part of Japan, next to East China Sea. The bay has a great tidal range (approx. 6 m) that creates the large mudflats in the innermost area. Our latest research demonstrated that the innermost area of Ariake Bay is utilized for nursery grounds of many elasmobranchs. For example, hammerhead sharks, Sphyrna lewini and S. zygaena, immigrate into the innermost areas of the bay for parturition during the summer season. In Ariake Bay, genus Dasyatis is abundantly distributed and some of them are economically important. We had confirmed that six Dasyatis species ( Dasyatis acutirostra , D. akajei, D. izuensis, D. laevigata, D. zugei, D. sp.) inhabit in the bay. Except for D. izuensis, five species also give birth to neonates mainly from June to August in the bay, which emerge in the innermost area including estuaries. They feed mainly on gammarids, mysids, and small fish there. In addition to its high productivity, the environmental conditions of the innermost area are characterized by highly turbid waters, which may provide suitable feeding grounds and shelters against predatory sharks to their neonates.
GALLAGHER, AUSTIN. 2012.
University of Miami
Evolved for Extinction? The rise and fall of the hammerhead sharks
The hammerhead shark is arguably one of the most recognizable and mysterious species on the planet, a fascinating example of biodiversity and evolution. The large hammerheads are apex predators and hold significant ecological importance in structuring food web dynamics and function. Recent scientific assessments of this Family of sharks suggest that they are among the most exploited globally. To illustrate the drivers of such declines, we suggest that all hammerhead sharks have become victims of an ̳evolutionary trap.‘ Evolutionary traps occur when aspects of a species‘ selected biology and ecology intersect with human disturbance factors to lead to maladaptive outcomes (i.e., mortality, fitness loss). While these phenomena have been widely documented in terrestrial systems and has subsequently led to increased conservation attention for certain species, similar evidence in marine systems is lacking. We present novel insights and quantitative data on this issue by linking biological (life-history), evolutionary (phylogeny), physiological (high stress response), behavioral (schooling and migrations), economic (high economic value to the finning industry) and human/ social (irrational fear and disvalue) drivers of an evolutionary trap specific to large hammerhead sharks. Finally, we discuss these findings in terms of risk assessment and conservation triage.
GALVÁN-TIRADO, CAROLINA; DÍAZ-JAIMES, PÍNDARO; GARCÍA DE LEÓN, FRANCISCO JAVIER; GALVÁN-MAGAÑA, FELIPE; URIBE-ALCOCER, MANUEL. 2012.
(CGT) Posgrado en Ciencias del Mar y Limnología – UNAM; (PDJ,MUA) Instituto de Ciencias del Mar y Limnología – UNAM, Mexico, Mexico; (FJGL) Laboratorio de Genética para la Conservación, Centro de Investigaciones Biológicas del Noroeste (CIBNOR), La Paz, Mexico; (FGM) Centro Interdisciplinario de Ciencias Marinas (CICIMAR), La Paz, Mexico
Genetic differentiation of silky shark (Carcharhinus falciformis) populations in the Pacific Ocean
The population genetic structure of the silky shark Carcharhinus falciformis in the Pacific Ocean was studied using analysis of the mtDNA control region. A 732 bp fragment was sequenced in 353 silky shark individuals; analysis provided 14 haplotypes. Mean haplotype (0.48 ± 0.03) and nucleotide diversity (0.0009 ± 0.00008) were unusually low for pelagic species. The AMOVA analysis comparing Western and Eastern regions was at a low but significant level of variance associated with differences between groups (ΦCT = 0.0199, P = 0.008). We present the first population genetic study of the silky shark in the Pacific and provide evidence that there are Eastern and Western Pacific populations. Even thought, the significance on the levels of population subdivision found, it is hard definitively to reject the hypothesis of panmixia because of the small differences registered owing to the low levels of mtDNA genetic variation. Based on our results and on the levels of population exploitation, we suggest evaluating the adoption of a two-stock management strategy to sustain the long-term use of this resource.
GARDINER, JAYNE; ATEMA, JELLE; HUETER, ROBERT; MOTTA, PHILIP. 2012.
(JG,RH) Mote Marine Laboratory, Sarasota, FL, United States; (JA) Boston University, Boston, MA, United States; (PM) University of South Florida, Tampa, FL, United States
Multimodal Integration and Sensory Plasticity in Shark Feeding Behavior
Multimodal sensory input directs simple and complex behaviors in animals, but most research to date has focused on individual senses. We investigated three species of sharks from different ecological niches: benthic, suction-feeding nurse sharks hunt nocturnally for fish; ram-biting bonnethead scoop crustaceans off the bottom of seagrass beds; and ram-feeding blacktip sharks rapidly chase down midwater teleost prey. We deprived animals of information from the senses (olfaction, vision, mechanoreception, and electroreception), alone and in combination, to elucidate their complementary and alternative roles in detecting, tracking, orienting to, striking at, and capturing live prey. This work revealed similarities and differences among species in the use of the senses for particular behaviors. In most cases, multiple senses can be used for the same behavioral task. Thus, sharks are capable of successfully capturing prey, even when the optimal sensory cues are unavailable, by switching to alternative sensory modalities. This indicates that feeding behavior is plastic. Nurse sharks rely on olfaction for detection, and track using olfaction combined with vision, the lateral line, or touch. They orient to prey using the lateral line, vision, or electroreception, but will not ingest food if olfaction is blocked. Capture is mediated by electrosensory or tactile cues. Bonnetheads normally detect prey using olfaction, use olfaction combined with vision or the lateral line to track, vision to line up a strike, and electroreception for capture. They can detect, orient, and strike visually in the absence of olfactory cues. Blacktip sharks can also detect prey using olfaction or vision. They use olfaction combined with vision or the lateral line to track. Long-distance orientation and striking is visually mediated but strikes are fine-tuned just prior to capture using the lateral line. Short-range orientation and striking can occur in the absence of vision using lateral line cues. Capture is mediated by electrosensory or tactile cues. The blacktip shark shows the greatest amount of modulation in capture kinematics, followed by the nurse shark. Little to no modulation was observed in the bonnethead. These results suggest that capture is less plastic in elasmobranchs than in bony fishes and that modulatory ability varies by species.
GELSLEICHTER, JIM; GRUBBS, DEAN; HEITHAUS, MICHAEL; LEARY, ARIANNE; PIERCY, ANDREW. 2012.
(JG,AL,AP) University of North Florida, USA; (DG) Florida State University Coastal and Marine Laboratory, USA; (MH) Florida International University, USA
Effects of the Deepwater Horizon Oil Spill on deepwater shark populations from the northeast Gulf of Mexico.
As the largest oil spill in history in U.S.-controlled waters, the Deepwater Horizon Oil Spill resulted in extensive contamination of Gulf of Mexico waters. This poses significant health risks to numerous marine wildlife populations, especially deepwater species residing in offshore waters within and/or adjacent to the primary contamination zone. Given the population-level impacts that have occurred in some wildlife species as a result of chronic exposure to oil constituents from prior oil spills (e.g., Exxon Valdez oil spill), it is critical to monitor the health of the Gulf‘s deepwater fauna to assess the full impacts of the Deepwater Horizon Oil Spill on these animals. Therefore, to address this problem, the goal of this study was to determine if deepwater fish assemblages in the northeast Gulf of Mexico are being exposed to and are experiencing effects of exposure to polycyclic aromatic hydrocarbons (PAHs), the most toxic constituents of oil. To accomplish this, we examined 4 biomarkers of PAH exposure and effects in multiple deepwater elasmobranch species collected from areas impacted by the Deepwater Horizon Oil Spill: 1) activity of the PAH-metabolizing Phase I biotransformation enzyme, cytochrome P450 1a1 (Cyp1a1); 2) biliary concentrations of PAH metabolites; 3) the occurrence of covalent associations between PAH metabolites and DNA; and 4) chromosomal abnormalities. PAH biomarkers were compared with those measured in deepwater sharks collected from unimpacted reference locations on the west Florida shelf. Cyp1a1 activity was significantly greater in sharks from oil-impacted locations compared with those from reference sites, suggesting that deepwater sharks are exhibiting physiological effects of oil exposure. However, evidence for cell- and organ-level effects was minimal, perhaps indicating that heighted oil exposure and metabolism is still below the threshold necessary to elicit higher level responses.
GERAGHTY, PASCAL; MACBETH, WILLIAM; WILLIAMSON, JANE; WINTNER, SABINE; JOHNSON, GRANT; OVENDEN, JENNIFER; GILLINGS, MICHAEL. 2012.
(PG,JW,MG) Macquarie University, Sydney, N, Australia; (WM) NSW Department of Primary Industries, Sydney, N, Australia; (SW) KwaZulu-Natal Sharks Board, Umhlanga, South Africa; (GJ) Department of Resources, Darwin, NT, Australia; (JO) Molecular Fisheries Laboratory, Brisbane, Q, Australia
Contrasting population structures suggest different evolutionary histories for three large, coastal shark species off eastern Australia
Commercial catches of large sharks in eastern Australian waters are dominated by three species: Carcharhinus plumbeus (sandbar shark), C. obscurus (dusky shark) and C. brevipinna (spinner shark). Life-history traits render these species highly vulnerable to over-exploitation. Despite significant management and conservation concerns currently surrounding the targeting of these sharks, very little is known of their biology in local waters. This study examined the genetic diversity and population structure of these three species off the east coast of Australia, as well as over a broader spatial scale for C. brevipinna, using a mitochondrial gene marker [857 base pairs of NADH dehydrogenase subunit 4 (ND4)]. Sequence data for 442 C. plumbeus, 428 C. obscurus and 430 C. brevipinna revealed contrasting haplotype networks, suggesting that present-day populations of these species off eastern Australia have been shaped by dramatically different evolutionary histories. Spatial genetic-homogeneity was observed for both C. plumbeus and C. obscurus populations despite the presence of distinct clades. We hypothesise that discrete, closely-related lineages, having evolved in isolation following a temporary barrier to gene-flow within a previously mixed population, have subsequently become re-integrated within the study area. In contrast, C. brevipinna appears to have undergone a significant population expansion event, and exhibits evidence for restricted maternal gene-flow over both intermediate and broad spatial scales. Such differing population structures suggest that sustainable management requires assessment at a species level.
GIRESI, MELISSA; RENSHAW, MARK; PORTNOY, DAVID; GOLD, JOHN. 2012.
(MG,MR,DP,JG) Texas A&M University, USA
Molecular Identification of Smooth-hound Sharks in the Gulf of Mexico
The morphological similarity of sharks in the family Triakidae (the smooth-hound sharks) has led to considerable taxonomic confusion and problems in species identification. The lack of clear and accurate identification methods for smooth-hound sharks prevents reliable species-specific landing estimates and obscures the ability to accurately assess species composition. Within the Gulf of Mexico, there are four nominal species in the genus Mustelus: M. canis, M. higmani, M. norrisi, and M. sinusmexicanus. While there are a multitude of studies that utilize microsatellites to elucidate population structure of a single species, the fact that microsatellites often amplify in closely related species is under-utilized. In this study, multiplex microsatellite PCR reactions are presented, which can be utilized to reliably distinguish between the four Mustelus species inhabiting the Gulf of Mexico. Elucidating the spatial distribution patterns of smooth-hound shark resources in the Gulf of Mexico is a critical first step to species management.
GRASSMANN, MICHAEL; NATANSON, LISA; SLAGER, CHRISTINA; HERBERT, KEITH. 2012.
(MG,CS,KH) Aquarium of the Bay, San Francisco, CA, United States; (LN) NOAA Fisheries, Narragansett, RI, United States
Observations of Growth and Demography in Captive-Born Pacific Angel Sharks (Squatina californica), at Aquarium of the Bay
In May of 2009, seven Pacific angel shark ( Squatina californica ) pups were born in the Aquarium of the Bay in San Francisco, California. This is the first reported case of successful captive-breeding for the species. The data collected on these specimens offer a unique opportunity to closely observe the early stages of age-related growth in Pacific angel sharks. Over two and a half years data were regularly collected on each shark‘s length, weight, average consumption, and the percentage body weight consumed. Based on these length data, three variations of von Bertalanffy were generated. Small sample size and rapid early growth in the population produced highly variable data with low confidence values in the first two trials. The third trial incorporated additional data from wild adult Pacific angel sharks that were previously tagged or collected by Aquarium of the Bay. This growth curve was compared to the previous trials and showed juvenile growth falling on approximately the same curve as adults. The parameters obtained in the final trial were also consistent with those derived from previously published data on the growth of Pacific angel sharks, despite the differences in some life history traits and highly variable growth rates of this specific population. Continued observation will help determine if these parameters change with further development, and if the initial variation in life history characteristics will influence other traits as the sharks reach maturity.
GRAY, TEAGEN; BERNARD, ANDREA; CLARKE, S.; CHAPMAN, D.; MCAULEY, R.; SHIVJI, M.S.. 2012.
(TG,AB,MS) Save Our Seas Shark Center USA and Guy Harvey Research Institute, Nova Southeastern University, FL USA 33004; (SC) Oceanic Fisheries Programme, Secretariat of the Pacific Community, BPD5 CEDEX, Noumea 98848, New Caledonia; (DC) School of Marine and Atmospheric Sciences, Stony Brook University, NY, USA; (RM) Department of Fisheries, Government of Western Australia, Hillarys, WA, Australia, Australia
Global phylogeography of the dusky shark (Carcharinus obscurus) based on nuclear microsatellite DNA analysis: delineation of genetic stocks and the geographic sourcing of shark fins from commercial markets.
The dusky shark, Carcharinus obscurus , is a globally distributed, coastal- pelagic species subject to an apparent high level of exploitation. The International Union for the Conservation of Nature (IUCN) lists this species as ―Vulnerable‖ globally, and ―Endangered‖ within western North Atlantic and Gulf of Mexico waters due to an over 80% decline in this region, with no evidence of population recovery. The extensive exploitation of dusky sharks may partly be attributed to the high market value of its fins, but the contribution of individual dusky shark stocks to the fin markets is unknown. This knowledge would be helpful to detect if specific stocks are experiencing disproportionate levels of exploitation. Due to its susceptibility to overfishing, current dire conservation status and need for additional information on its population dynamics, we analyzed the genetic population structure and genetic diversity of the dusky shark (n = 301) across 10 globally distributed locations utilizing 10 nuclear microsatellite loci.
Surprisingly, dusky sharks showed similar allelic richness and gene diversity (A=10.5-11.4; H e = 0.64- 0.66) across all populations despite the more severe IUCN classification and a history of severe population decline in the western North Atlantic. The microsatellite marker analyses support previously published mtDNA work, identifying a strong divergence among Atlantic and Indo-Pacific samples ( F ST = 0.01-0.15; P <0.05). Overall, microsatellite marker results indicate the presence of three genetically discrete management units for dusky sharks, due to the significant genetic differentiation found between the western North Atlantic, South African, and Australian collections and the low frequency of migrant exchange between these populations.
Additionally, these nuclear microsatellite-defined, discrete management units provide a method for the assignment of market derived fins to their population of origin with the use of genetic assignment techniques, including Bayesian multi-clustering methods (Structure) and principal coordinate analysis. Using these sourcing techniques, 15 of 21 market fins analyzed were found to have likely originated from the highly endangered western North Atlantic dusky shark population, supporting the need for more urgent conservation measures within this region.
GRUBBS, DEAN; GELSLEICHTER, JAMES; HEITHAUS, MICHAEL; KIRK, GASTRICH; CHARLES, COTTON. 2012.
(DG) Florida State University; (JG) University of North Florida, Jacksonville, FL, United States; (MH,KG) Florida International University, Miami, FL, United States; (CC) Virginia Institute of Marine Science, Gloucester Point, United States
Demersal Elasmobranch Assemblages associated with Desoto Canyon and the Continental Slope of the Eastern Gulf of Mexico relative to the Deepwater Horizon Oil Spill
Edge habitats typically have high biodiversity and biomass regardless of ecosystem, but such deep-sea habitats (e.g. continental slopes, submarine canyons, seamounts) remain relatively unexplored and little information on community structure exist. DeSoto Canyon and adjacent continental slope habitats of the eastern Gulf of Mexico were the first affected by the Deepwater Horizon oil spill (DwH). Deep-water fishes, especially the elasmobranchs, have slow life histories and are among the most sensitive taxa to environmental perturbations yet in the Gulf of Mexico these taxa are poorly documented, many species are taxonomically unresolved and new species undoubtedly exist. We developed a fishery-independent survey employing longlines and traps in concert to describe the deep-water assemblages of large demersal fishes in this region. During 2011-2012, three research cruises were completed and stations from 199m to 2,014 m deep were sampled offshore of the Mississippi Delta, through the DeSoto Canyon (including the DwH site), and offshore of St. Petersburg, Florida. More than 1,000 fishes were captured including at least two species of hagfishes, more than 15 species of elasmobranchs and more than 20 species of teleosts. Sharks ranging in size from 20 cm TL ( Galeus area ) to 500 cm TL ( Hexanchus griseus ) were captured using these methods. We will present a cluster analyses describing distinct fish assemblages mediated by depth (85% were captured <600 m deep), temperature and bottom type. Regional comparisons of community structure, species richness, and relative abundances will be presented and related to the DwH oil spill.
GUTTRIDGE, TRISTAN; BROWN, CULUM. 2012.
(TG) Bimini Biological Field Station Foundation; (CB) Macquarie University, Sydney, Australia
Learning and memory of port jackson sharks, heterodontus portusjacksoni
Basic understanding of the fundamental principles and mechanisms involved in learning are extremely lacking for cartilaginous fishes. Our aim in this study was to experimentally investigate the learning and memory capacity of juvenile Port Jackson sharks, Heterondontus portusjacksoni . Sharks (N = 30) were conditioned over a 19-day period to associate an underwater LED light or stream of air bubbles (conditioned stimulus, CS) with a food reward (unconditioned stimulus, US), in three procedures (delay, trace and control) . During experiments the CS signaled at a random time between 180 and 300s for 30s. For delay (US overlapped in time with CS), for trace (US delivered 10s after CS) and for control (US delivered random time between 180 and 300s after CS). H.portusjacksoni trained in all procedures improved consistently in their time to obtain food, indicative of learning. Importantly the number of sharks in the feeding area 5s prior to the CS signaling did not change over time for any procedures. However, significantly more sharks were present 5s during CS signaling for delay (air bubble) and trace (light). Sharks trained in the delay and trace procedures (air bubble CS) also displayed significantly more anticipatory behaviors, such as turning towards the CS and biting. Sharks trained with the light CS did not exhibit any biting behaviors however trace procedural sharks did show a significant improvement in turning towards the CS at its onset. At 40 and 20 days after the end of the conditioning experiments some sharks were presented the CS without reward. Two sharks trained in the delay procedure (air bubble CS) exhibited movement and biting behaviors. This study demonstrates that H.portusjacksoni have the capacity to learn a classical conditioning procedure relatively quickly (some in <5 days), associate two time-separated events and retention of learnt associations for up to 40 days.
HAMADY, LI LING; NATANSON, LISA; SKOMAL, GREGORY; THORROLD, SIMON. 2012.
(LLH) MIT/Woods Hole Oceanographic Institution; (LN) National Marine Fisheries Service, NOAA, USA; (GS) Massachusetts Division of Marine Fisheries, USA; (ST) Woods Hole Oceanographic Institution, USA
Testing white shark, basking shark, and dusky shark age estimation techniques using bomb radiocarbon validation
Accurate age estimation is critical to population assessment and conservation strategies for sharks and rays as it allows for the calculation of important demographic information including longevity, growth rate, and age at sexual maturity; m anagement decisions based on under aging can inadvertently lead to overexploitation . The primary method for estimating age of sharks relies on counting pair-bands that are assumed to be annual in vertebrae. While it is widely acknowledged that the assumption of annual deposition should be tested by an independent method, most shark species lack this validation. White sharks (Carcharodon carcharias) , basking sharks ( Cetorhinus maximus ), and dusky sharks ( Carcharhinus obscurus ) are listed as vulnerable on the IUCN Red List of Threatened Species due to a history of overfishing, and all three currently lack age validation. We present new radiocarbon data taken from analyses of shark vertebrae and compare and contrast the different results from the three species. We hope that this work will inform and assist with conservation efforts for all three species.
HARRIS, LINDSAY; BEDORE, CHRISTINE; KAJIURA, STEPHEN. 2012.
(LH,CB,SK) Florida Atlantic University, USA
Bioelectric fields of elasmobranch prey
All aquatic organisms produce minute yet complex electric fields around their body as a result of internal ion concentrations that differ from those in the environment. Ion leakage across mucous membranes results in greater electric field strengths around the mouth and gills where they are modulated by opercular movements during respiration. The divergent electrical properties of freshwater and saltwater present different challenges for electroreceptive predators like elasmobranch fishes (sharks, skates, and rays) that detect the bioelectric fields of their prey. This study employed an electrophysiological technique to measure the voltage and frequency of electric fields produced by various elasmobranch prey items in both fresh and saltwater. Three marine invertebrates, eight marine fishes, and three freshwater fishes representing a broad taxonomic range and lifestyle were c hosen for this study. Overall, the fishes produced a greater average voltage than the invertebrates (marine fishes 134.15 μV; freshwater fishes 849.59 μV; invertebrates 16.8 μV). All fishes generated the greatest voltage near the mouth and gills ( marine average 113.0 μV, freshwater average 765.18 μV) and the smallest voltage along the trunk and caudal peduncle ( marine average 13.76 μV, freshwater average 41.18 μV) . The amplitude of the bioelectric potential did not correlate with size or mass of the prey items. The frequency component ranged from 0.61 Hz at the mouth of the freshwater tiger oscar Astronotus ocellatus to 11.1 Hz at the swimmerets of the marine shrimp Penaeus spp. These frequencies fall within the range of detection for elasmobranchs (<20 Hz). Decay of the electric field with distance was also measured, and bioelectric potentials could be measured up to 5 cm away from the mouth of the freshwater fishes, and 15 cm from the mouth of the marine fishes. From these voltage data, the electric field gradient (μV/cm) was modeled to estimate from how far an elasmobranch could detect the electric potential of a prey item. Marine elasmobranchs should be able to detect a teleost prey item from 32-75 cm away based on an average electrosensitivity of 35 nV/cm. Sensitivity data are lacking for freshwater elasmobranchs so detection distances of freshwater prey remain unknown, but are the subject of ongoing research.
HARRISON, LUCY; DULVY, NICK. 2012.
(LH,ND) IUCN Shark Specialist Group, Burnaby, BC, Canada
Towards a Species Conservation Strategy for Sawfish
All seven species of sawfish are globally listed as Critically Endangered by the IUCN Red List and are listed on CITES; both the smalltooth and largetooth sawfishes are listed on the US Endangered Species Act. Sawfishes were formerly widespread in tropical and subtropical coastal waters, with some species extending into freshwater. However, their distribution is now severely fragmented, and some sawfish are thought to be locally extinct from large parts of their former range, for example in the Gulf of Mexico, West Africa and the Indo-Pacific. Because of this, and their k-selected life history, there is a very real risk that this ecologically unique and evolutionarily distinct lineage will vanish in our lifetime due to an intrinsic vulnerability to extinction. The IUCN Shark Specialist Group develops Species Conservation Strategies (SCS) for species that would benefit from immediate conservation action, i.e. sawfishes. Here, we describe the Species Conservation Strategy process and review the current status of sawfishes, summarize current conservation activities and provide priority recommendations for further action.
HEITHAUS, MICHAEL; CINDY, BESSEY; BURKHOLDER, DEREK; FOURQUREAN, JAMES. 2012.
(MH,BC,JF) Florida International University, North Miami, United States; (DB) North Miami, North Miami, United States
Do tiger sharks influence seagrass ecosystems through multiple indirect pathways?
The importance of large-bodied herbivores in structuring seagrass ecosystems in undisturbed seagrass communities has begun to receive considerable attention. Less appreciated is the possibility that the structuring role of these herbivores was driven by top-down impacts of large predators (e.g. sharks) that also have undergone dramatic declines in many regions. The potential for large predators to modify the spatiotemporal pattern and intensity of herbivory is further complicated by their broad diets and the possibility that they might indirectly influence seagrass communities through multiple pathways that could serve to amplify or attenuate the strength of top-down effects. We used the relatively pristine seagrass ecosystem of Shark Bay, Western Australia as a model system for investigating top-down effects of grazers and top predators in the absence of major anthropogenic impacts. Using a combination of nested exclosures and seagrass transplant experiments, as well as surveys of habitat use and abundance of tiger sharks (top predators), megagrazers (turtles, sea cows), piscivores, and mesograzers (teleosts) we investigated potential shark-induced trophic cascades through multiple pathways. Both pathways appear to have the potential to mediate indirect effects of tiger sharks on seagrasses and likely work in concert to amplify top-down impacts. Combined with other studies showing the potential of grazers at high population densities to heavily impact seagrass beds, our results suggest that the loss of top predators could have important consequences for the structure and stability of seagrass ecosystems.
HINOJOSA, SILVIA. 2012.
UNAM
Genetic Differences between Giant Manta ray (Manta birostris) and the Yucatan Giant Manta ray.
Based on coloration and morfological differences, the existence of a possible third species for the genus Manta has been suggested in previous studies. At least two morphotypes with variations in mouth, ventral and dorsal colorations as well as in some key morphological features has been observed in the giant manta of the Mexican Carribean. In order to test the hypothesis about whether those differences are produced by environment or have a genetic basis we used several mitochondrial DNA markers both nuclear (RAG1) and mitocondrial (ND5, COI, 12S and 16S), to determine if there are enough differentiation levels to further contribute to the definition of the possible third manta ray species previously reported. In addition samples of M. birostris and Manta sp .were sent to be analyzed by new generation sequencing techniques to create a genomic library and to look for otrher possible differences in the complete mitocondrial genome. This work reveals our primary findings using ND5 and COI genes. The DNA from 30 samples collected at Holbox Mexico and Revillagigedo Islands, were amplifyed , sequenced, aligned and compared to determine if it exists enough genetic variation between the Mexican populations and the previously reported species ( Manta birostris ). The sequences for each mtDNA region, are being compared with those of Pacific in order to estimate the mean genetic divergence and their correlation with isolation processes.
HOEN, DANIELLE; DRAZEN, JEFFREY; POPP, BRIAN; CONDON, NICOLE. 2012.
(DH,JD,BP,NC) University of Hawaii Manoa, USA
Does elasmobranch trophic position increase with depth? Interpreting bulk isotope data with compound-specific isotope analysis of amino acids
Increasing fishing pressure and the threat of climate change make understanding the trophic biology of poorly studied deep water chondrichthyans critical. Increasingly, bulk isotope analyses are utilized to determine trophic relationships among these organisms. However, there is much uncertainty when interpreting bulk isotope data in an ecological context. For instance, changes in baseline isotopic composition and possible fractionation differences among organisms complicate bulk isotope analyses. It was recently found that chondrichthyan 15N enrichment increases with depth, suggesting an apparent increase in trophic position (TP) with depth. It has been hypothesized the production of urea by these species may be lowering nitrogen isotope fractionation. If this is the case, decreasing urea content with depth would drive a subsequent increase in nitrogen isotope fractionation, leading to the apparent increase in TP indicated by bulk isotope data. We analyzed the livers of two species of skate, Raja rhina and Amblyraja badia (median depth of occurrence: 539 m and 1585 m respectively), caught from a depth gradient ranging over 1500 m using compound specific isotope analysis of amino acids in addition to glutamate dehydrogenase and glutamine synthetase enzyme assays to determine if this trend was a product of baseline δ15N changes, a change in nitrogen isotope fractionation, or an actual increase in TP. Phenylalanine δ15N values varied little over this depth range, indicating no change in baseline δ15N values. Rather the apparent trend may be driven by changes in fractionation due to urea retention. These results serve to caution researchers and fisheries managers when making assumptions about ecosystem dynamics in the deep sea based on bulk isotope data.
HOLLENSEAD, LISA; CARLSON, JOHN; BETHEA, DANA; GRUBBS, R. DEAN. 2012.
(LF) Florida State University; (JC,DB) NOAA NMFS Panama City Laboratory, Panama City, FL, United States; (RDG) Florida State Coast Marine Laboratory, St. Teresa, FL, United States
Monitoring movement patterns of juvenile smalltooth sawfish (Pristis pectinata) using acoustic monitoring and tracking in a nursery habitat in southwest Florida
Historically, the U.S. range of smalltooth sawfish stretched from North Carolina to Texas including the Gulf of Mexico. Due to fisheries bycatch, habitat loss, and a low productivity, the US population has declined leading to their inclusion on the U.S. Endangered Species Act in 2003. Necessary to their recovery is a description of critical habitat, mandated in the Smalltooth Sawfish Recovery Plan. Using passive acoustic telemetry and active tracking, precise delineation of smalltooth sawfish activity space and patterns of habitat use can be determined. Juvenile smalltooth sawfish less than 1.5 meter total length were fitted with two Vemco acoustic tags. An R coded tag was used to passively monitor movements with an array of 32 VR2w receivers in Everglades National Park and 3 VR2w receivers in Faka Union Bay, Florida. A continuous tag was used for active tracking using a VR100 hydrophone. In 2011, 24 animals were captured and fitted with acoustic transmitters. Residency time was found to be longer than previously hypothesized with animals remaining in the system through out the winter months. Seven animals were actively tracked for a minimum of 4 hours and a maximum of 32 hours. Benthic samples and mangrove habitat properties were measured in an effort to create a habitat selectivity model. For the benthic samples, percent sand, silt, clay and organic content were measured. Mangrove habitat was measured throughout the two study sites and was categorized by branch overhang, prop root density, and rhizome density. Other abiotic factors (temp, depth etc) were also measured.
HOLMES, BONNIE. 2012.
(BH) University of Queensland
Long-term movement patterns of satellite tagged tiger sharks (Galeocerdo cuvier) in southeastern Australia
The tiger shark (Galeocerdo cuvier) is one of the highest trophic order predators in Australia‘s coastal marine waters. Described as a tropical species, G. cuvier movements into southern sub-tropical and warm temperate waters have previously been assumed to occur seasonally in the austral summer. Determining movement patterns and habitat use is vital for better understanding the role of tiger sharks in structuring coastal communities. As a species potentially dangerous to bathers, it is also important to understand when and where interactions with humans are likely to occur. Pop-up archival (PAT) and Smart Positioning or Temperature Transmitting (SPOT) satellite tags were used to investigate seasonal movement and site fidelity of tiger sharks in southern Queensland and northern New South Wales. A total of 12 tiger sharks were tagged between 2007–2011 across a range of sizes, sexes and seasons. Preliminary results indicate that some large and small tiger sharks of both sexes will remain in southern Queensland waters during the cooler winter months. Depth profiles obtained from PAT tags indicated maximum depths of over 1760 m, deeper than previously reported for the species, with water temperatures as low as 5.9 degrees celsius. The greatest distance travelled was ≈1800 km, from Botany Bay NSW to New Caledonian waters after 48 days at liberty. Notwithstanding this, the majority of individuals maintained some fidelity to the coastal zone highlighting the importance of near-shore habitat. We hypothesise that habitat utilisation is driven predominantly by prey availability.
HOWEY-JORDAN, LUCY; BROOKS, EDWARD; BROOKS, ANNABELLE; ABERCROMBIE, DEBRA; WILLIAMS, SEAN; JORDAN, LANCE; CHAPMAN, DEMIAN. 2012.
(LHJ,JL) Microwave Telemetry, Inc.; (EB,AB) Cape Eleuthera Institute; (DB) Abercrombie and Fish; (SW) Stuart Cove, USA; (DC) Stony Brook University, USA
Time well spent: Substantial use of the Bahamas shark sanctuary by mature female oceanic whitetip sharks revealed by pop-off satellite archival tags
Once considered among the most abundant pelagic predators, the oceanic whitetip shark (Carcharhinus longimanus) has drastically declined in the last few decades due to overexploitation. This species is especially impacted in the western Atlantic Ocean, where it is currently listed as ―Critically Endangered‖ by the International Union for the Conservation of Nature (IUCN). Cat Island in The Commonwealth of The Bahamas is one of the few places where this species is regularly observed. After banning longline fishing in the mid-1990s, The Bahamas recently prohibited commercial shark fishing in its 630,000 km 2 Exclusive Economic Zone (EEZ). The goals of our study were to: 1) quantify the time oceanic whitetips spend within this EEZ, 2) determine long-term movements of individuals as they moved away from The Bahamas, and 3) characterize the vertical and thermal habitat use of this understudied pelagic species. We deployed pop-up satellite archival tags on 11 adult female sharks near Cat Island in May 2011 as a pilot effort to achieve these goals. Another female shark was opportunistically tagged 420 km south of Cape Hatteras, USA. Eleven tags reported, collecting a total of 1,563 days of tracking data. Four tags were physically recovered, adding greater resolution to the dataset – 1,146,959 depth and temperature records combined. Mean depth used by tracked sharks was 43.9 m (± 10.34 SD) and the mean temperature encountered was 26.1 °C (± 0.55 SD). The deepest dive observed was 1081.9 m and the coolest temperature experienced was 7.75 °C. Reconstructed tracks revealed that tagged individuals moved long distances (some more than 1,000 km from tagging site) over a wide area but spent substantial amounts of time (approximately 58 % of days tracked) within the Bahamian EEZ. It therefore appears likely that the Bahamas longline ban and newly implemented shark sanctuary has and may continue to provide a significant refuge for this threatened species.
HUTCHINSON, MELANIE; ANDERSON, JAMES; O’SULLIVAN, JOHN; HOLLAND, KIM. 2012.
(MH,JA) University of Hawaii, USA; (JO) Monterey Bay Aquarium, USA; (KH) Hawaii Institute of Marine Biology, USA
A multiple instrument approach to elucidate the movement and dive behavior of scalloped hammerhead sharks (Sphyrna lewini) in Hawaii
Hammerhead sharks, Sphyrna lewini, use coastal embayments such as Kaneohe Bay, Hawaii, as nursery grounds. Although considerable insights have been gained into the behavioral ecology of the pups in these nursery areas, little is known about the behavior of the adults after they leave the bay or the extent of the ̳catchment area‘ from which these adults come. To elucidate the behavior and dispersal of these seasonal visitors to Kaneohe Bay we fitted seven adult male hammerhead sharks with electronic tags; four with archiving pop-up (PAT) tags, four with position only (SPOT) satellite transmitters and one double tagged with both a PAT and a SPOT. All seven fish were also implanted with acoustic transmitters. Results from the PATs show offshore vertical ranges exceeding depths of at least 1250 m, which are previously un-documented for this species. Vertical profiles showed very clear diel dive activity. Tagged hammerheads also exhibited previously unrecorded thermal tolerances to at least 3°C, spending an average 34.7% of their time in temperature ranges from 3° – 6° C. Horizontal movement data suggest that these adults stay close to the Hawaiian Islands – an interpretation supported by the acoustic tag data which revealed repeated visits to Kaneohe Bay over an extended period of time. However, these data are not yet extensive and are limited to males. Nevertheless, these early results reveal an unexpectedly large vertical range for this species in the offshore waters of Hawaii and indicate that hammerheads have a wide ecological niche that probably includes deep water prey.
JACOBY, DAVID; BROOKS, EDWARD; CROFT, DARREN; SIMS, DAVID. 2012.
(DJ,DS) Marine Biological Association of the UK, Plymouth, United Kingdom; (EB) Cape Eleuthera Institute, Bahamas; (DC) Centre for Research in Animal Behaviour, Exeter, United Kingdom
Developing a deeper understanding of shark movements and spatial dynamics through novel application of network analyses
Understanding how and why sharks move within their environment is fundamental for the effective management and conservation of many threatened elasmobranch species. With site fidelity and home ranging behaviour common in sharks, there is a need to determine how fine-scale space use changes with ontogeny, sex, phenotype and a variety of abiotic variables. For some time, passive acoustic telemetry techniques employing static arrays have been used to gather discrete packets of data pertaining to the presence or absence of individually tagged sharks at known receiver locations. A major limitation of current approaches for analysing these data is that they rarely account for the interconnectivity of these locations as the sharks move freely between them. As a result, traditional analyses do not integrate graphically or statistically a temporal component to spatial changes. Hence, the spatio-temporal structure of movements and habitat use is often hard to extract and compare for large numbers of individuals using the same habitats. Here we present the novel application of network theory to passive acoustic telemetry data which describe the movements of two very distinct species, the Caribbean reef shark ( Carcharhinus perezi ) and the small spotted catshark ( Scyliorhinus canicula ). This approach treats specific locations as network nodes and the movement of sharks between receivers as network edges. Some descriptive and quantitative analyses that are possible with this new technique are highlighted and assessed in relation to their application to enhanced management and conservation strategies.
JAIME, MARIO; CARAVEO, JAVIER; GALVAN, FELIPE; HOYOS, MAURICIO. 2012.
(MJ,JC) CIBNOR; (FG) CICIMAR; (MH) Pelagios-Kakunjá
Relative contributions of feeding in the different regions to the long-term diet of the white shark Carcharodon carcharias from Isla Guadalupe inferred by analysis of stable isotopes d15N and d13C
Movements of white shark in the Eastern Pacific and the link with its feeding ecology were inferred from stable carbon and nitrogen stable isotopic analysis. Dermis and epidermis samples of white sharks that aggregate at Isla Guadalupe were obtained to determine isotope composition. Average isotope signature for dermis tissue of white shark were δ 13 C (–14.5‰) and δ 15 N (19.1‰). Average isotope signature for the epidermis was δ 13 C (–14.1‰) and δ 15 N (18.3‰). Tissue samples of prey (northern elephant seals, Guadalupe fur seals, California sea lions, and dolphin) were obtained. Isotope signatures of probable white shark prey within its migration range were obtained from the literature (h arbor seals, northern elephant seals, northern fur seals, harbor porpoise and fishesfrom the coast of the California, yellow fin tuna, bigeye tuna and albacore from Hawaii and yellow fin tuna values near the Shark Offshore Forraging Area) We considered the marine mammals as indicators of near shore environments and tunas as indicators of off shore environments. Guilds by regions instead of species were grouped. To compare the definition pattern of the distribution of feasible contributions from each source to the white shark we developed mixing models using IsoSource and MixSIR software. The isotope signature of white shark dermis from Isla Guadalupe suggests movements of individual sharks between Isla Guadalupe and the coast of California. Results of models indicated a greater contribution of prey from nearshore environments than those of offshore environments.
JAMES, KELSEY; FERRETTI, FRANCESCO; MOORE, JEFF; LEWISON, REBECCA; CURTIS, K. ALEXANDRA; DILLINGHAM, PETER. 2012.
(KJ,RL) San Diego State University, USA; (FF) Hopkins Marine Station, Stanford University, USA; (JM) Southwest Fisheries Science Center, NOAA, USA; (KAC) Acadia University, USA; (PD) Clark University, USA
Global Chondrichthyan Catch and Bycatch: Status and Sustainability
Chondrichthyan populations are at risk from fisheries catch and bycatch worldwide. However, assessing the impact of fishing mortality on sharks and rays is difficult given severe data limitations. As a result, few fisheries management organizations have applied management models to identify limits or reference points that could address chondrichthyan catch sustainability. In collaboration with colleagues, we are addressing this challenge by creating a global catch database linking catch and bycatch data with chondrichthyan life history, and developing reference point based models to guide management of chondrichthyan catch. This project is a continuation of the Project GloBAL bycatch database and builds on this foundation with ongoing work by Stanford‘s Reconstructing Shark Baselines project. Here, we will review the structure and content of our chondrichthyan catch database and its links with demographic information, and discuss the application of management models using these data. This collation and synthesis of chondrichthyan catch and bycatch data will improve our ability to assess and manage the impact fisheries are having on chondrichthyan populations.
KACEV, DAVID; HYDE, JOHN; LEWISON, REBECCA; BOHONAK, ANDREW. 2012.
(DK,RL,AB) SDSU, USA; (JH) Southwest Fisheries Science Center, USA
Using Genetics in a Mark-Recapture Framework to Estimate Population Size of Data Poor Elasmobranchs
Accurate estimation of the size of wild populations is critical for effective management, but incredibly difficult in pelagic ecosystems. Traditional population assessments have relied upon fisheries catch records to generate CPUE trends, however this is difficult for non-target species where data can be very sparse. In this study, we developed a model using population genetic data in a mark-recapture framework to generate a rough estimate of population size. We simulated data for 16 microsatellite loci using average allelic richness and allele distributions drawn from a wild population of short fin mako sharks. We then ―bred‖ these individuals by choosing two at random and randomly selecting one allele per locus from each to create an offspring genotype. From each paring we generated one to four offspring based on litter sizes found in the literature. We thus created an f1 generation based on 10 years of the model run. We sampled the genotypes of the f1 generation and used these data to reconstruct the putative parental genotypes, which could then be compared to known adults, and assigned each to its putative parents. The first time an offspring was assigned to a putative parent, it was considered a mark on that parent, and each subsequent assignment of an offspring to that parent was considered a recapture. These mark-recapture data were used in a Jolly-Seber model to generate an estimate of the putative adult population, which could then be compared to the actual adult population size to assess the utility of this method for population size estimation. We then tested this framework using actual mako shark population genetic data.
KAJIURA, STEPHEN; TELLMAN, SHARI. 2012.
Florida Atlantic University, USA
Quantification of massive seasonal shark aggregations
South Florida witnesses an enormous migration of marine apex predators each year as massive aggregations of blacktip ( Carcharhinus limbatus ) and spinner sharks ( C. brevipinna ) move through the area. The close proximity of the Gulf Stream to the Palm Beach County (PBC) shoreline may constrain the sharks to the coastal environment with tens of thousands of individuals congregated in the shallow, nearshore waters. This natural bottleneck in PBC provides a unique opportunity to estimate abundance of the southeastern US population of these important apex predators during their annual migration. Over a sixteen month period, a biweekly aerial survey was flown along the 75km length of PBC from Boca Raton inlet to Jupiter inlet with a high definition video camera and digital SLR camera mounted out of the window of the plane to provide a continuous record of the area from the shore seaward to about 200m. The light-colored, sandy seafloor and clear water characteristic of PBC facilitate visualization of the sharks close to shore. The number of sharks was counted and used to generate a seasonal population estimate but since the survey sampled only sharks close to shore at depths less than 5m, the total population size is actually much greater. Shark abundance peaked in the winter (February) and declined to nearly zero in the summer months and was inversely correlated with water temperature. The sharks were not uniformly distributed along the coast, but appeared in loose clusters of up to thousands of individuals. Although sharks could be found along the entire length of PBC, the stretch of coastline between Boynton Inlet and Palm Beach Inlet consistently exhibited the greatest numbers of sharks. There was no apparent correlation between shark abundance and proximity to inlets or reef structure. In addition to sharks, seasonal abundance of other large marine vertebrates, including mantas and manatees, was also quantified, although neither demonstrated the massive aggregations seen in the sharks. These baseline abundance data can be used as a comparison for future studies to determine if shark population size is changing and if sharks are restricting their southward migration as global water temperatures increase. Future studies will employ electronic tagging of sharks to determine the extent of their movements along the eastern seaboard.
KIM, SORA; CASPER, DAVE; MARTÍNEZ DEL RIO, CARLOS; HOEN, DANIELLE; POPP, BRIAN. 2012.
(SK,CMR) University of Wyoming, USA; (DH,BP) University of Hawaii, USA; (DC,PK) University of California, Santa Cruz, USA
Discrimination factors and incorporation rates for carbon and nitrogen isotopes from a long term feeding study with sharks
Stable isotope analysis has provided insight to the dietary and habitat patterns of many birds, mammals, and teleost fish. Crucial biological parameters to interpret field stable isotope data are discrimination factors and tissue incorporation rates, which are not well studied in large vertebrate ectotherms. Sharks have a unique physiology and a carnivorous diet, which likely affect their metabolic biochemistry and these biological parameters. Because sharks have relatively slow metabolic rates and are difficult to maintain in captivity, no long-term feeding study until isotopic steady state with a diet has been conducted. Leopard sharks ( Triakis semifasciata ) were fed controlled diets for 31⁄2 years in captivity. The control group ate a constant diet of squid and the experimental group was switched to tilapia, an isotopically distinct diet. Plasma, red blood cell, and muscle isotopic values were monitored throughout the experiment to calculate discrimination factors and incorporation rates. Although discrimination factors were similar to mammalian carnivores, tissue incorporation rates were an order of magnitude slower than previously published studies. This discrepancy is likely due to the relatively slow metabolic rate of ectotherms and large size of these leopard sharks in comparison to other feeding study subjects. Furthermore, discrimination factors for liver, skin, and vertebrae were estimated for bulk tissue isotopic compositions and for individual amino acids from white muscle tissue for individuals collected at the experiment‘s termination. These results are the first robust discrimination factors and incorporation rates for a suite of tissues from a long term controlled feeding study with sharks.
KNUCKEY, JAMES; CLERKIN, PAUL; EBERT, DAVID. 2012.
(JK,PC,ED) Moss Landing Marine Laboratories, USA
Biodiversity and Conservation of Western Indian Ocean Chondrichthyans
The biodiversity of the Western Indian Ocean chondrichthyans is relatively unknown compared to other better studied regions, such as the western North Pacific, North Atlantic , and Indo-Pacific regions. The Western Indian Ocean has at least 279 species overall, with 152 shark species, 120 batoid species, and 8 chimaera species. This number comprises 23.3% of the approximately 1 ,200 valid species of chondrichthyans. The sharks are more diverse than the batoids, but this is most likely due to more attention having been paid to the sharks than the batoids in this region. The Carharhiniformes (82 species), Myliobatiformes (46 species), Squaliformes (36 species), and Rajiformes (29 species) are the most dominant groups in terms of species-richness within this region. The close proximity of the Western Indian Ocean to the Indo-Pacific, which has been shown to be a center of origin for the marine tropics, may explain the relatively high number of species. Most chondrichthyan species accounted for in this study are coastal species, which may explain why some of the families have lower numbers than reported in other regions, such as the Rajiformes; a species group known to generally occur in deeper waters of the tropics. Islands and island chains show a high degree of endemism compared to the continental shelf and upper slope habitats. The majority of species found in this region are listed as Data Deficient (100 species), Near Threatened (54 species), or Vulnerable (51 species) on the IUCN Red List. Enhanced identification of Western Indian Ocean chondrichthyans is crucial for developing improved management and conservation policies for this group.
KOLMANN, MATTHEW; HUBER, DANIEL; DEAN, MASON; GRUBBS, DEAN. 2012.
(MK,DG) Florida State University Coastal & Marine Laboratory, USA; (DH) University of Tampa, USA; (MD) Max Planck Institute, USA
Feeding performance in a durophagous stingray
Durophagy is a feeding strategy which is typified by the majority of an organism‘s diet being comprised of hard-shelled invertebrates. Implicit in this definition is not only the ingestion of hard-shelled prey but also the mechanical dismantling of the prey carapace. The cownose ray, Rhinoptera bonasus, is a large coastal pelagic stingray thought to specialize on bivalve prey. Investigation of feeding performance in such an animal is particularly interesting in such that the ray‘s skeletal structure is oftentimes much more compliant than the skeleton of its prey. Using traditional morphometric analysis of jaw adductor muscle architecture coupled with physiological estimations of muscle forces we use a three-dimensional static equilibrium model which calculates bite forces in cownose rays over their ontogeny. Additional considerations of our model include the notion of asymmetrical biting and a jaw lever system shift which maximizes mechanical advantage. Here we present the first biomechanical model for a myliobatiform stingray using bite force as a performance metric. Preliminary data regarding bite force production in Rhinoptera over their ontogeny show force production spanning from 17 N in neonate animals to over 200 N in mature adults. Concern regarding the effect of cownose ray predation on commercial bivalve species is addressed with consideration to ecomorphology, specifically how high bite forces in Rhinoptera translate to feeding success on commercial shellfish.
KROETZ, ANDREA; DRYMON, J. MARCUS; POWERS, SEAN P.. 2012.
(AK,SPP) University of South Alabama, Dauphin Island Sea Lab, USA; (DJM) Center for Ecosystem Based Fishery Management, Dauphin Island Sea Lab, USA
Did the Closure of Katrina Cut Impact the Movements of a Coastal Shark?
Bonnetheads ( Sphyrna tiburo ) are highly mobile fish that occupy dynamic coastal environments. Identifying the factors influencing the distribution of these fish is essential for understanding potential impacts induced from anthropogenic alterations to coastal ecosystems. Dauphin Island is a barrier island that was split into two halves in 2005 by Hurricane Katrina. This opening, known as Katrina Cut, allowed for water flow between the Gulf of Mexico and Mississippi Sound and also served as a potential passageway for mobile consumers to move freely between the two water bodies. Following the Deepwater Horizon oil spill in 2010, Katrina Cut was closed off by a solid rock wall in an attempt to prevent oil from reaching the shoreline. Acoustic telemetry was used to asses if altering Dauphin Island‘s natural coastline hindered ingress/egress of bonnetheads into Mississippi Sound. There were changes in bonnethead movement from 2010-2011. Prior to the closure of Katrina Cut, bonnethead detections were concentrated in a small area proximal to the cut during spring and summer of 2010. Following the closure of Katrina Cut, telemetered sharks relocated to the west tip of Dauphin Island and Petit Bois Island, MS during spring and summer 2011. A shift in preferred prey, habitat or abiotic parameters all present possible explanations for the shift in distribution of this coastal shark. Regardless of the mechanism, acoustic telemetry presents a means by which to identify a rapid shift in habitat use by a mobile consumer in response to an anthropogenic alteration.
KUHNZ, LINDA; BIZZARRO, JOSEPH; DAVID, EBERT. 2012.
(LK) MBARI; (JB) University of Washington, Seattle, United States; (EB) Pacific Shark Research Center Moss Landing Marine Laboratories, Moss Landing, United States
In-situ Observation of Deep-living Skates in the Eastern North Pacific
We report on in-situ observations of more than 500 deep-sea skates from between 600 and 3,322 m among a variety of locations, including: the Pacific Northwest, northern California, the Monterey Canyon, central California seamounts, southern California basins, and the Gulf of California. Physical information (i.e., geographic location, depth, habitat associations), and biological data (i.e., species, sex, maturity, behavior) were evaluated. Multiple skates of an unknown species were observed below 3,000 m and represent some of the deepest visual observations of skates. Several additional unidentified species were observed. This study also extends the maximum depth range of Amblyraja badia, Bathyraja abyssicola, and B. spinosissima.
LANA, FERNANDA; HAZIN, FÁBIO; OLIVEIRA, PAULO; REGO, MARIANA; ROQUE, POLLYANA. 2012.
Federal Rural University of Pernambuco
Reproductive Biology, Relative Abundance and Distribution of Silky Shark, Carcharhinus falciformis (Muller & Henle, 1939), in the Southwestern and Equatorial Atlantic Ocean
The present work aimed at studying the ecology of the silky shark, Carcharhinus falciformis , including aspects of its reproduction, relative abundance, distribution, habitat use and migration in the Equatorial Atlantic Ocean. From November 1992 to December 2011, 153 specimens were examined, 72 males and 81 females, resulting in a sex ratio close to 1:1 (0.89:1.00). All specimens were caught by commercial tuna longline boats, in the area located between the latitudes of the 008°N to 053°S and longitudes 008°E to 048°W. The results suggest a size at first maturity for females around 205- 210 cm and for males between 180- 205 cm TL. Females were found in 5 maturational stages: juvenile (n = 29/ 35.8% from 74 – 204 cm, TL), maturing (n = 10 / 12.3%, from 215 – 295 cm TL), pre- ovulatory (n = 14 / 17.3%, 177 – 280 cm TL), pregnant (n = 24 / 29.6%, 203 – 270 cm TL) and resting (n = 4 / 4.9%, from 223 – 285 cm TL). Males were classified into 4 stages: juvenile (n = 38/ 52.8% from 81 – 220 cm TL and clasper length – CL <12 cm), maturing (n = 16/ 22.2%, from 166 – 208 TL cm, 9.5 – 24.5 cm CL;), adult (n = 17/ 23.6%, from 141 – 272 cm TL, CL> 24.5 cm) and neonate (n = 1/ 1.4%, 82 cm TL, CL 4 cm). The ovarian fecundity ranged from 2 to 60 follicles and uterine fecundity from 7 to 25 embryos. The distribution and relative abundance were analyzed based on catch and effort data from 16.016 sets made by Brazilian tuna longliners, from 2004 to 2011. The area with the highest concentration was located between latitudes 005oN and 020oS and between longitudes 020oE and 040oW. The proportion of silky sharks in relation to the total catch in numbers and catches of sharks in general, equal to 0.2% and 6.4%, respectively, were very low, showing the character of their incidental catches. The habitat preferences and their distribution in depth, temperature ranges and vertical movement, were analyzed using PSAT tags (Pop-up Satellite Archival Tag) in the vicinity of Archipelago of Saint Peter and Saint Paul – ASPSP. Two males of silky sharks of 130 cm and 100 cm TL each were tagged with PSAT programmed to remain in the animal for 73 days collecting data. The preferred temperature range displayed by the species was between 27 – 28° C with a preferred depth between 1 – 10m, showing a markedly shallow distribution for the species. The animals also exhibited a marked superficial behavior during the day and a little deeper at night.
LARSON, SHAWN; GRIFFING, DENISE; HOLLANDER, JOEL; CHRISTIANSEN, JEFF. 2012.
Seattle Aquarium, USA
Summary of sixgill shark tagging and abundance estimates from 2003-2009 in the urban inland waters of Elliott Bay, Seattle
Anecdotal reports of diver-shark encounters in the Pacific Northwest stimulated interest in the normally deep-dwelling, poorly studied bluntnose sixgill shark (Hexanchus griseus) and the reason for its presence in the shallow waters of the Salish Sea. Capture/Mark/ Recapture techniques were used to identify individual sharks for population structure and movement pattern analysis. Temporal changes in relative abundance in Puget Sound are reported from a controlled study site (2003-2005) at the Seattle Aquarium and citizen sighting/encounter reports (2000-2009). At the Seattle Aquarium study site on Elliott Bay, Seattle, 45 sixgills were tagged with modified Floy visual marker tags, along with an estimated 116 additional untagged sixgills observed via video camera. The majority of sixgills observed were adolescents, and they were found to be significantly more abundant in the summer months. Observations of sixgills peaked in 2003-2005 and declined to very few observations from 2006-2009. While conservation measures have been enacted in Washington and British Columbia waters, additional measures may be necessary as large, long-lived sharks like sixgills are thought to be unable to sustain exploitation.
LOTTI, MATTHEW; WETHERBEE, BRADLEY; GRACE, MARK; DRIGGERS, WILLIAM. 2012.
(ML,BW) University of Rhode Island, Kingston, RI, United States; (MG,WD) NOAA/NMFS/SEFSC, Pascagoula, Pascagoula, MS, United States
At-vessel mortality and related factors among three carcharhinid sharks caught by fisheries- independent bottom longline surveys in the U.S. Gulf of Mexico and the Northwest Atlantic Ocean
Mortality rates among commercially-caught elasmobranchs in the US must be carefully monitored to ensure stock sizes are not declining past renewable levels. Catch limits restrict fishermen from excess shark retention, but if discarded individuals suffer high levels of at-vessel mortality, less protection is offered by such management. The U.S. commercial bottom longline fishery utilizes gear soak times in excess of 9 hours and this soak period that has been shown to correlate to at-vessel mortality for many shark species, especially among those that use obligate ram ventilation. The NOAA/NMFS/Southeast Fisheries Science Center, Mississippi Laboratories bottom longline survey utilizes only 1 hour soak times per set. However, even with a reduced soak time, at-vessel mortality still occurs. The purpose of this research was twofold: 1.To determine mortality rates for three shark species commonly-caught by commercial bottom longline fisheries in the Gulf of Mexico and western North Atlantic: scalloped hammerhead Sphyrna lewini , blacktip Carcharhinus limbatus , and Atlantic sharpnose Rhizoprionodon terraenovae; 2. Investigate specific biological, technical, and environmental factors correlated to at-vessel mortality in light of a controlled soak-time. At-vessel mortality after 1 hr was found to be >11% for S. lewini, C. limbatus, and R. terraenovae . The probability of at-vessel mortality was found to decrease for each species as length and bottom DO content increased. For S. lewini , males were found to have a higher probability of at-vessel mortality than females. Among C. limbatus, sharks caught on J hooks were found to have greater probability of at-vessel mortality than those caught on circle hooks. For R. terraenovae, the probability of at-vessel mortality was found to increase with bottom water temperature. Restricting the commercial bottom longline shark fishery from areas of low DO may decrease rates of shark at-vessel mortality, and with it, potential discard mortality. Use of circle hooks over J hooks is recommended to reduce at-vessel mortality among C. limbatus . Additionally, fishing in lower temperature areas may serve to reduce at-vessel mortality among R. terraenovae . These results may facilitate the creation of more species-specific management for elasmobranchs.
LOWE, CHRISTOPHER; ALEXANDER, XYDES; FORNEY, CHRISTINA; MANII, ESFANDIAR; MOLINE, MARK; CLARK, CHRISTOPHER. 2012.
(CL) California State University Long Beach; (XA,CF,EM,MM,CC) California Polytechnic State University, San Luis Obispo, San Luis Obispo, CA, United States
The future of elasmobranch behavior research: The development and utility of smart shark tracking robots
The evolution of acoustic telemetry tracking technology has significantly advanced our knowledge and understanding of elasmobranch behavior. Yet despite these advancements there are still logistical and economic limitations to characterizing behavior of shark and rays in the wild. To reduce some of these constraints we have developed an automated acoustic telemetry tracking system for characterizing the diel fine-scale movement patterns and habitat use of highly mobile coastal elasmobranchs. This system utilizes a team of customized Iver2 Ocean Server autonomous underwater vehicles (AUV) equipped with paired hydrophones and receivers. AUVs are able to track a tagged shark and determine its position using particle filter estimation, while simultaneously characterizing the seafloor and water column surrounding the shark. Experiments demonstrate that localization of stationary and mobile transmitters in coastal environments and autonomous tracking of tagged leopard sharks using AUVs have position estimation errors better than those obtained via manned active tracking. Specialized AUV controller programming is designed to reduce behavioral interference, while identifying and characterizing changing patterns of movement.
LUER, CARL; WALSH, CATHY; RITCHIE, KIM; YORDY, JENNIFER; MIEDEMA, JODI; BODINE, A.B.; CANNONS, ANDREW; LUNA, VICKI. 2012.
(CL,CW,KR,JY,JM) Mote Marine Laboratory, USA; (ABB) Clemson University, USA; (AC,VL) USF Center for Biological Defense, USA
Antimicrobial Properties of Epidermal Mucus from Two Species of Ray (Cownose Ray, Rhinoptera bonasus, and Atlantic Stingray, Dasyatis sabina)
The protective secretion produced by epidermal mucus cells in stingrays is being investigated to identify mucus-associated antimicrobial compounds with the potential for development into novel therapeutics to treat wound infection pathogens. Freshly obtained epidermal mucus from cownose rays ( Rhinoptera bonasus ), and Atlantic stingrays ( Dasyatis sabina ) can be separated by gentle centrifugation into an aqueous supernatant and a viscous pellet. The aqueous supernatant contains at least 20 proteins/protein subunits based on SDS polyacrylamide gel electrophoresis. Chemical extraction of fresh mucus with 1) Tris-EDTA, 2) acetic acid and solid phase extraction, and 3) selected surfactants (Triton X-100, Tween 80, and N-octylglucoside) results in partial purification of mucus compounds. Fresh mucus also contains bacterial symbionts that are not seawater contaminants. Forty-six of 384 bacterial isolates cultured from R. bonasus and 49 of 227 isolates from D. sabina epidermal mucus demonstrated antibiotic activity against at least one human pathogenic tester strain in primary screens performed at Mote Marine Laboratory. Of the 46 R. bonasus isolates, 13 demonstrated antimicrobial activity against a different panel of pathogenic bacterial tester strains when screened at University of South Florida Center for Biological Defense. Using the GenBank database, BLAST searches performed on 16S rDNA sequence data identified six different genera among 22 of the 49 D. sabina -derived bacterial isolates that produced antibacterial compounds against various tester strains. Some of the active isolates not genetically confirmed with the database could be undescribed organisms. Culturable libraries of all isolates have been cryopreserved.
LYONS, KADY; CARLISLE, AARON; BLASIUS, MARY; MULL, CHRISTOPHER; WINKLER, CHUCK; O’SULLIVAN, JOHN; LOWE, CHRISTOPHER. 2012.
(KL,MB) California State University Long Beach, Long Beach, CA, United States; (AC) Hopkins Marine Station, Pacific Grove, CA, United States; (CM) Simon Fraser University, Burnaby, BC, Canada; (CW) Southern California Marine Institute, Terminal Island, CA, United States; (JO) Monterey Bay Aquarium, Monterey, CA, United States; (CL) California State University Long Beach, Long Beach, CA, United States
Levels of Organic Contaminants and Mercury in Four Species of YOY Lamnid Sharks
During reproduction, females have the ability to transfer accumulated contaminants to offspring by a process called maternal offloading. Since organic contaminants are biomagnified through the food web, a mother‘s the trophic level should highly influence the magnitude and composition of contaminants passed to developing young. Liver contaminant concentrations were measured in four species of young of the year (YOY) lamnid sharks caught in southern and central California to compare the degree of maternal contaminant transfer from females with varying diets. YOY white sharks (n=19) had the highest levels of organochlorine contaminants among all four groups (∑PCBs 14 ± 10 μg/g ww [wet weight], ∑DDTs 75 ± 87 μg/g ww), followed by mako sharks (n=4; ∑PCBs 7 ± 7 μg/g ww, ∑DDTs 13 ± 75 μg/g ww), thresher (n=1; ∑PCBs 2.8 μg/g ww, ∑DDTs 5.7 μg/g ww) and salmon sharks (n=17; ∑PCBs 0.6 ± 0.5 μg/g ww, ∑DDTs 0.7 ± 0.6 μg/g ww). YOY white sharks also had the highest level of total mercury in their muscle (∑Hg 1.4 ± 1.1 μg/g ww) compared to salmon sharks (∑Hg 0.3 ± 0.1 μg/g ww). YOY white sharks were also the only species to show contaminant signatures (high DDT:PCB ratio) indicative of foraging from the Palos Verdes Superfund site. While diet and foraging location of YOY sharks may play a role, the amount of contaminants accumulated by these young sharks is probably highly influenced by their mothers. Therefore, adult lamnids such as white and mako sharks that feed on highly contaminated marine mammals are more likely to pass higher loads of contaminants to their offspring. The elevated contaminant levels of these young animals are of concern since the physiological effects of these contaminants on health and reproduction are unknown.
MARQUEZ-FARIAS, J FERNANDO; SMITH, WADE; RODRÍGUEZ LÓPEZ, JORGE E; LARA-MENDOZA, RAUL E.. 2012.
(JFMF,JERL,RELM) Facultad de Ciencias del Mar. Universidad Autónoma de Sinaloa, Mexico
Growth and migration of Scalloped Hammerhead Shark Sphyrna lewini from the Nursery in the Southern Gulf of California, México
In the absence of parental care, some species shark used shallow areas for the birth of their offspring. In these areas, the newborn will find food and protection against predation. The cohort of sharks that born in a given season does not migrate from the breeding area until they achieve a certain size. However, prior to migration, the cohort of newborns must survive to birth and stay alive in the nursery area. We investigated the hammerhead sharks in the coastal zone of southern Sinaloa monitoring the artisanal shark fishery. Based on observations of the umbilical wound condition was possible to determine the state of development which was encoded in open (0= neonate) and closed (1= juvenile). Using a binary logistic regression, we determined the proportion of neonates (y) that survive to birth as function of length (x). The value of L50% of the logistic function represents when half the cohort survived the birth event given the healed wounds. We note that sharks are born around 43 cm TL in late May and reach L50% = 53 cm TL in few weeks. The growth of juveniles continues until February of the following year. At 83 cm TL, half the cohort born in the season has migrated from the nursery area. We discuss the sources of natural mortality for age-0 and the implications of directed fishing in nursery grounds.
MATICH, PHILIP; HEITHAUS, MICHAEL. 2012.
Florida International University, North Miami, FL, United States
Resource pulses drive seasonal variability in bull shark trophic ecology
Estuaries are characterized by considerable variation in both abiotic and biotic conditions across multiple spatial and temporal scales. This variation can lead to spatial and termporal variation in food web dynamics. Within the Florida Coastal Everglades, much of the estuarine habitat is oligotrophic, and prey resources for upper trophic level predators are generally scarce. Thus, resource pulses that enter the ecotone region of the estuary during the dry season when marsh species migrate to channels, could be important in the diets of estuarine predators. We used stable isotope analysis of an estuarine top predator, juvenile bull sharks, to elucidate variation in trophic interactions in space and time and with changes in shark size. Carbon isotopic values of bull sharks in the Shark River Estuary suggest that they take advantage of the freshwater resource pulse during the dry season. However, data suggest that all sharks do not rely on this pulse of food, which may be attributed to physical tolerances, trade-offs, prey preference, foraging experience, and/or individual specialization. Our study shows the potential importance of large, highly mobile predators, like bull sharks, in linking freshwater and estuarine food webs, and the complexity of Everglades‘ trophic dynamics. Further research investigating the timing of these resource pulses and quantifying the biomass that enters channels during the dry season may provide insight into how the physical changes caused by proposed restoration efforts may lead to important biological changes.
MCCALLISTER, MICHAEL; DIGIROLAMO, TONY; GELSLEICHTER, JIM. 2012.
(MM,JG) University of North Florida, USA; (TD) Florida Fish and Wildlife Commission, USA
Understanding the effect of prey abundance on habitat selection for the Atlantic sharpnose shark (Rhizoprionodon terraenovae) in a northeast Florida estuary
Sharks are considered top predators in many marine ecosystems, and can play an important role in structuring those communities. As a result, it is important to understand the factors that influence the abundance and distribution of sharks. One hypothesis is that the abundance and distribution of predators is driven by the abundance of potential prey resources. The goal of this study was to examine the influence of prey abundance on habitat selection for Atlantic sharpnose sharks in a northeast Florida estuary. Atlantic sharpnose sharks were caught in Cumberland Sound from 2009 – 2011 and catch rates were compared between open sound habitat and protected creek habitat. Stomach contents of sharks caught in 2010 –2011 were analyzed to determine the preferred prey items of Atlantic sharpnose sharks. The abundance of potential prey items in sound and creek habitats was determined from finfish abundance data obtained from the Florida Fish and Wildlife Conservsation Commission. Catch rates of Atlantic sharpnose sharks in open sound and creek habitat were compared with the abundances of their preferred prey items found in those habitats. Understanding patterns of habitat use and foraging behavior can provide insight on how predators select habitat, and the importance of those habitats. This is particularly important as management efforts continue to focus on identifying essential fish habitats.
MCCUTCHEON, SARA; KAJIURA, STEPHEN. 2012.
Florida Atlantic University, USA
Lanthanide metals as potential shark deterrents
Sharks comprise a large portion of unwanted bycatch in longline fisheries worldwide and various technologies and modifications to fishing protocols have been proposed to reduce elasmobranch bycatch. Since bycatch species are often trophically similar to target species, technologies need to be developed to specifically reduce elasmobranch bycatch without impacting the catch of target species. Lanthanide metals have been proposed as an elasmobranch-specific repellent. When submerged in a polar solution, such as water, lanthanide metals undergo a hydrolytic reaction and release electrons, which produces a charge distribution in the water. The charge produced by the metals likely exceeds anything that sharks naturally encounter in the wild and will presumably overwhelm their electrosensory system. We evaluated the efficacy of lanthanide metals as potential shark deterrents. Specifically, we quantified the electrical charge produced by six lanthanide metals in seawater, compared their dissolution rates, and performed a behavioral assay to determine effectiveness against two shark species. We found that there was no difference in the voltage produced by the six tested metals in ambient seawater. The charge distribution decayed as a power function with distance from the metal sample. From the function for voltage decay with distance we derived the function for the voltage gradient (ie. electric field). Based upon the median sensitivity reported for six elasmobranch species, we calculated that sharks should detect a sample of neodymium at a minimal distance of 65-85 cm. The dissolution rate for the lanthanides varied from -1.6 to -0.2 g/h. As the metals dissolved the voltage remained constant presumably due to more extensive pitting which increased 3D surface area despite a decrease in mass. In a behavioral assay, neodymium was ineffective at repelling bonnethead sharks (Sphyrna tiburo) tested individually and in groups, and lemon sharks (Negaprion brevirostris) in groups. Therefore, due to high cost, fast dissolution rates, and lack of deterrent effects, lanthanide metals are not recommended for use in mitigating shark bycatch.
MCFARLANE, GORDON A.; CISNEROS, ANDRES; KING, JACQUELYNNE; SUMAILA, RASHID. 2012.
(GAM,KJ) Fisheries and Oceans Canada, Canada; (CA,RS) UBC, Canada
Economic Impacts of Shark Conservation in British Columbia
Although data-deficiency often hinders formal assessments, it is widely recognized that shark species around the world have historically been overfished. In British Columbia, three shark species have been listed under the Species at Risk Act (SARA) as Endangered or Special Concern. Currently these listings have not required bycatch mitigation in fisheries which encounter these shark species. It is recognized that conservation measures in the form of fishery restrictions will have economic costs from the adaptation of an industry to new restrictions. In the case of fisheries these costs follow from limitations on catch (targeted or incidental) leading to reductions in fishing effort, which can result in lowered catch and profits. We examine the potential economic costs of mandated bycatch reduction, with a conceptual case study. We chose two model species: bluntnose sixgill shark (Hexanchus griseus) which is the most common SARA-listed bycatch species in the British Columbia groundfish fishery; and Pacific halibut (Hippoglossus stenolepis) which is the most economically important groundfish fishery in British Columbia. We ask the overarching question: ―Undercurrent fishing conditions, what effect might sixgill shark bycatch limitations have on the BC halibut fishery?‖
MCPHERSON, DIANA; BLAIYOK, KAUTCHANG; MASSE, BRUCE; HELFMAN, GENE. 2012.
(DM) FIN Photography; (KB) N/A, Koror, Republic of Palau; (BM) ENV-ES Enviornmental Stewadrship Group, Los Alamos, NM, United States; (GH) Univ of Georgia, Lopez Island, WA, United States
Large jacks attack and kill Blacktip Reef Sharks
Adult sharks have few natural enemies aside from other sharks. Documented attacks by bony fishes are exceedingly rare. We report several instances of highly aggressive, fatal, non-consumptive attacks on Blacktip Reef Sharks (Carcharhinus melanopterus) by Giant Trevally (Caranx ignobilis). Our direct observations and informant‘s reports suggest that large Giant Trevally and other carangids pursue and ram sharks at several Indo-Pacific locales. Carangids head-butt sharks behind the gills and above the pectoral fins, causing blood to stream from the gill region. Attacks continue until a shark is immobilized, despite obvious injury to the head of the trevally. An attacking carangid continually outmaneuvers its victim, restricts its escape efforts, and thwarts apparent attempts by other sharks to defend an individual under attack. Post-mortem examination of sharks indicates damage to several internal organs. These attacks differ from oft-reported incidents of mobbing. We seek information on similar interactions to determine if this turning of the tables is a common phenomenon.
MCPHIE, ROMNEY; KING, JACQUELYNNE. 2012.
Department of Fisheries and Oceans, Canada
Diel vertical migration of bluntnose sixgill sharks (Hexanchus griseus) in the Strait of Georgia, British Columbia
Previous observations on the diel activity patterns of bluntnose sixgill sharks ( Hexanchus griseus ) were most consistent with the hypothesis that foraging activity is responsible for their diel patterns of vertical movement. However, ecosystems vary with respect to physical processes (e.g. mixing, stratification and the depth of thermocline) as well as food web dynamics (e.g. prey abundance and availability). We used temporal depth and temperature data collected from pop-up satellite tags to test the foraging activity hypothesis for sixgills residing in the Strait of Georgia . Alternate hypotheses that might explain diel vertical migration patterns include the avoidance of predators and/or competitors, or thermoregulation. Our results extend the spatial scale of observations made in the nearby ecosystem, Puget Sound .
MCVEIGH, DOREEN. 2012.
Hood College
Genetic Analysis of Populations of the Cownose Ray, Rhinoptera bonasus, in the Chesapeake Bay and Gulf of Mexico.
Cownose rays, Rhinoptera bonasus , are elasmobranchs found in the Western Atlantic from Brazil to Massachusetts. In the spring and early summer, large schools of rays migrate into the Chesapeake Bay to forage. The rays also utilize the Chesapeake Bay as a nursery for young-of-the-year pups and a breeding ground. During the summer, cownose rays migrate throughout the polyhaline portion of the Bay, but it is not currently known if these subgroups of animals are genetically isolated. In this study, we analyzed DNA sequence variation from portions of two variable mitochondrial genes, cytochrome b and cytochrome c oxidase I, in samples collected from two sites in the Chesapeake Bay (St. George Island, MD and Reedville, VA) and from Tampa Bay, FL. Preliminary results indicate that there is a statistically significant difference in the distribution (p < 0.05) of haplotypes between the two Chesapeake Bay populations as well as a difference between Chesapeake and Tampa Bay populations. Florida and Reedville share a haplotype that is present in substantial frequencies (34% and 23%, respectively); this haplotype is absent from the St. George Island population. These results suggest that the two Chesapeake locations attract different southern source populations each summer.
MUCIENTES, GONZALO; QUEIROZ, NUNO; HUMPHRIES, NICHOLAS; SABORIDO, FRAN. 2012.
(GM,FS) IIM-CSIC, Vigo, Spain; (NQ) CIBIO, Vairão, Portugal; (NH,DS) MBA, Plymouth, United Kingdom
Movements, behaviour and habitat preferences of pop-up satellite tracked shortfin mako sharks (Isurus oxyrinchus) in the North Atlantic
The shortfin mako shark (Isurus oxyrinchus) is a highly migratory, pelagic species with circum-global distribution in tropical and temperate seas. This shark is commonly found in the Atlantic Ocean and are taken as bycatch in longlining and gillnetting operations for tuna and swordfish (Xiphias gladius), activities that have expanded rapidly during the last 20 years. High demand for fins and its good-quality meat mean makos are now highly prized by fishers. But despite the high prevalence, economic importance, and vulnerability of this species, little is known about its population dynamics and habitat-use. There is some evidence from conventional tagging and fishery studies that complex population structuring and movements may be contributing to recorded declines in the western Atlantic Ocean. Shortfin mako sharks may remain faithful to particular regions, which together with males and females apparently segregating into different regions for at least part of the year may result in differential exploitation of vulnerable components of the population (e.g. mature females, juveniles) exacerbating declines. The aim of this study is to elucidate for the first time the movements and behaviour of shortfin mako sharks from satellite- linked electronic tagging and relate this to remotely sensed environmental fields to identify fine-scale habitat preferences in the Atlantic Ocean. Pop-up archival transmitting (PAT) tags were deployed, recording vertical and horizontal movements and temperature preferences of mako sharks tagged in oceanic waters. Satellite tags were programmed to detach 30, 60, 90, 120 or 180 days after deployment. A total of 16 makos (8 males, 8 females) were caught and tagged in North Atlantic waters, specifically, in northwest, southwest and east of the Azores islands from 2009 – 2011. Tagged sharks ranged from 120 – 255 cm (fork length). Mako sharks displayed different movement and residency patterns, including a trans-Atlantic migration into western Iberia waters. Satellite tracked sharks also displayed deep diving behaviour into cold water, with maximum recorded depths of 1064 m (5.8 oC) with temperature preferences ranging from 5.8 and 27oC.
MULL, CHRISTOPHER; YOPAK, KARA; DULVY, NICHOLAS. 2012.
(CM,ND) Simon Fraser University, Canada; (KY) University of Western Australia, Australia
Reproductive Strategy, Brain Size and Structure in Chrondrichthyans
Chondrichthyans have the most diverse array of life-history and reproductive strategies of any vertebrate group, and also exhibit broad variability in the size and complexity of the brain and its major components (olfactory bulbs, telencephalon, diencephalon, mesencephalon, cerebellum and medulla). In vertebrates brain tissue is expensive to produce and maintain and represents a major energetic constraint particularly during development, and increased encephalization may be related to maternal investment. In mammals, larger brains are correlated with increased maternal investment in the form of longer gestation time and the duration of lactation. This leads to a hypothesis that brain size is related to maternal investment in offspring. Here, we test whether additional maternal investment, beyond the provisioning of a yolk, is associated with larger brain size across 146 species from 6 orders of chondrichthyans using classic and phylogenetic comparative analyses. We have previously shown that body size has a profound influence on brain size. Controlling for body size, we find that both reproductive mode (lecithotrophy and matrotrophy) and reproductive investment (development time and litter size) can partially explain variation in overall adult brain size. Matrotrophic species have larger brains across all body sizes, however, contrary to the expectation derived from mammals, gestation length had negative influence on brain size such that species with longer gestation typically had smaller brains and litter size had a positive influence such that species with larger litters tended to have larger adult brain sizes. Reproductive investment had a significant influence on the scaling of most major regions (telencephalon, mesencephalon, medulla and olfactory bulb), while diencephalon and cerebellum were best predicted by brain mass alone. Our results suggest a tentative link between reproductive mode and investment and brain size and organization that is worth investigating further. We suggest the development of a more refined phylogeny, detailed estimation of maternal investment, analysis of neonatal brain size and organization and measurement of ontogenetic patterns of brain growth may strengthen our understanding of the reproductive investment- brain development hypothesis.
MUSICK, JOHN; COTTON, CHARLES. 2012.
Virginia Institute of Marine Science, Gloucester Point, United States
Bathymetric limits of chondrichthyans in the deep sea
Chondrichthyans are largely absent in abyssal (>300m) habitats in in most regions of the world ocean are uncommon below 2000m. The deeper-living chondrichthyans include certain rajids, squaliforms and holocephalans. Several hypotheses have been erected to explain the absence of chondrichthyans from the abyss. These are mostly based on energetics: Deep-sea food webs are impoverished due to their distance from primary production, and chondrichthyans, occupying the highest trophic levels, cannot be supported due to entropy among trophic levels. We examine this hypothesis by comparing trophic levels, calculated from dietary data, of deep-sea chondrichthyans with those of deep-sea teleosts. Chondrichthyans were mostly above trophic level 4, whereas all the teleosts examined were below that level. The potential prey field for both chondrichthyans and teleosts declines in biomass and diversity with depth, but teleosts appear to have more flexibility in their feeding mechanisms and food habits.
NEWBY, JENNIFER; SHEDLOCK, ANDREW. 2012.
(JN) Grice Marine Laboratory, College of Charleston; (AS) College of Charleston, USA
An examination of population genetic and social structure in the spotted eagle ray (aetobatus narinari) found seasonally off coastal sarasota, fl
Recent global declines in chondrichthyan populations have risen as a major concern due to amplified pressure from fisheries. The spotted eagle ray, Aetobatus narinari , is a cosmopolitan myliobatoid recognized as near-threatened by the World Conservation Union however is not protected in U.S. federal waters. A decreasing population trend, K-selected life history and primarily inshore, coastal habitat renders this species susceptible to over-exploitation by targeted fisheries, drift netting, and capture as bycatch. Since 2009 large seasonal aggregations have been observed in the Gulf waters of Sarasota, FL. Modest ecological data is available for A. narinari but almost no studies of fine-scale genetic structure exist. We are presently investigating the molecular ecology of this A. narinari population using fin clips from individuals sampled non-invasively across the region through the Mote Marine Lab, Sarasota, FL, from April through November 2011. Genotypes of allele frequencies for 9 independent eagle-ray-specific microsatellite loci are being employed currently to elucidate the population genetic structure and social structure of eastern Gulf of Mexico (GOM) A. narinari . Standard tests for Hardy-Weinberg Equilibrium, null alleles and linkage disequilibrium as well as statistically significant patterns of geographic structure, direction and scale of gene flow, and kinship among possible parent-offspring associations will be discussed based on ecological, demographic and genetic data available. Synthesis of baseline molecular data from the present study in the eastern GOM and comparison to subpopulations in the Central Atlantic is expected to advance our global understanding of A. narinari vulnerabilities in this region.
NOSAL, ANDREW; LEWALLEN, ERIC; BURTON, RONALD. 2012.
(AN,RB) Scripps Institution of Oceanography, La Jolla, CA, United States; (EL) University of Toronto Scarborough, Toronto, ON, Canada
Low incidence of multiple paternity in leopard sharks (Triakis semifasciata) sampled from a predominantly female aggregation in southern California, USA
Knowledge of reproductive behavior is critical for understanding population dynamics of elasmobranch fishes. However, the ultimate and proximate causes of apparent mating systems are largely unresolved. Here, the percentage of litters sired by multiple males (frequency of multiple paternity, FMP) was determined for a sample of leopard sharks (Triakis semifasciata; n=19) captured from a predominantly female (97.1%) aggregation in La Jolla, California, USA. Four polymorphic microsatellite markers were isolated and developed from an enriched library constructed exclusively for T. semifasciata. These loci were amplified in a population sample of 138 presumably unrelated individuals (including 19 mothers) and found to exhibit moderate to high allelic diversity (9, 14, 16, and 18 alleles per locus, respectively) without deviating from Hardy-Weinberg expectations. The probability of detecting multiple paternity (PrDM) exceeded 0.99 for litters of 10 or more pups under varying degrees of paternal reproductive skew. That is, the probability of a multiply sired litter not having at least three unique paternal alleles at any locus (therefore being incorrectly identified as singly sired) was <0.01, thus demonstrating the power of the developed suite of microsatellite markers. A total of 380 pups were genotyped from 19 litters (mean litter size ± SD [range] = 21.6 ± 6.1 [11 – 33] pups). Only three of the 19 litters exhibited multiple paternity (FMP = 15.8%), each with no more than two sires having equal reproductive success. These results demonstrate that multiple paternity, and thus some degree of sperm storage is possible in this species. However, the observed FMP is among the lowest reported for any elasmobranch fish. The low FMP for T. semifasciata is not necessarily selectively advantageous or disadvantageous, but may rather be the inevitable consequence of sex-biased reproductive behaviors: females avoid harassment (superfluous mating attempts) by retreating to aggregation sites where males are largely absent.
O’SHEA, OWEN. 2012.
Australian Institute of Marine Science
Bioturbation by stingrays at Ningaloo Reef,
Stingrays are an important part of the biomass of the fishes in shallow coastal ecosystems, particularly in interreefal areas. In these habitats, they are considered keystone species – modifying physical and biological habitats through their foraging and predation. Here, we quantify the effects of bioturbation by rays on sand flats of Ningaloo Reef lagoon in Western Australia. We measured the daily length, breadth and depth of 108 feeding pits over three 7-day periods, created by stingrays ( Pastinachus atrus, Himantura spp. Taeniura lymma and Urogymnus asperrimus) in Mangrove Bay. Additionally, an area of , 1km 2 of the lagoon at Coral Bay was mapped three times over 18 months, to record patterns of ray and pit presence. Over 21 days at Mangrove Bay, a total of 1.08m 3 of sediment was excavated by rays, equating to a sediment wet weight of 760.8 kg, and 2.42% of the total area sampled, or 0.03% of the whole intertidal zone. We estimate that up to 42% of the soft sediments in our study area would be reworked by stingrays each year. Based on a model predicting the probability of pit presence over time, there was a 40% probability of ray pits persisting for 4 days before being filled in but only a 15% probability of a pit being present after 7 days. Changes in pit volume over time were static, providing evidence for secondary use. Our results imply that rays play an important ecological role creating sheltered habitats for other taxa in addition to the turnover of sediments
PASSEROTTI, MICHELLE; ANDREWS, ALLEN; CARLSON, JOHN; WINTNER, SABINE; NATANSON, LISA. 2012.
(MP) NOAA/NMFS; (AA) NOAA/NMFS, Aiea, HI, United States; (JC) NOAA/NMFS, Panama City, FL, United States; (SW) KwaZulu-Natal Sharks Board, Umhlanga Rocks, South Africa; (LN) NOAA/NMFS, Narragansett, RI, United States
Age validation in sand tiger shark, Carcharias taurus, using bomb radiocarbon analysis
There is a great deal of ambiguity in the age and growth data of sand tiger shark (Carcharias taurus). Of particular concern is the observed maximum age based on vertebral band counts. To address this uncertainty, archival vertebrae of sand tiger sharks from both the north Atlantic and south Indian Oceans were processed for bomb radiocarbon analysis in an effort to validate growth band periodicity and longevity in the species. Vertebral centra from 10 individuals were chosen for analysis based on capture date and size at capture, and sectioned to a thickness of 2mm using an Isomet low speed saw. One half of the section was left at this thickness and mounted for micromilling, while the other half was sanded to a thickness of 0.5mm and mounted for ageing. Age estimates for each shark were obtained by counting growth band-pairs assuming annual band-pair deposition, and were used in conjunction with date of capture to assign a year of formation for each band-pair. Thin sections were used to guide marking of band-pairs on thick sections. A total of 36 growth band-pairs were milled from thick sections (n= 2 to 6 per vertebrae) for Δ14C/δ13C analysis. The measured Δ14C values for band-pairs/formation years will be compared with regional Δ14C reference chronologies including known-age porbeagle shark (Lamna nasus) and hermatypic corals. This comparison will either validate age estimates or will provide evidence for discrepancies in age from growth band counting. New estimates of age at maturity and longevity will be used to update the productivity for this species, which current data estimates to be strikingly low (i.e. population growth rates are negative) even in the absence of fishing pressure.
PETERSON, CHESTON; GRUBBS, DEAN. 2012.
(CP) Florida State University; (DG) Florida State University Coastal and Marine Laboratory, USA
Investigating the trophic ecology of sharks and teleost fishes in the Florida Big Bend using stable isotope analysis
The Florida Big Bend supports a high diversity of sharks and teleost fishes, but the region is poorly studied to date. This study aims to describe the trophic ecology of the sharks and large teleost fishes in one of the world‘s largest and most pristine seagrass beds. This area, nearly 300km in length, is bordered by important hard bottom habitat that acts as an intermediary between nearshore nursery areas and offshore adult habitats. White muscle biopsies were collected from most fishes caught during an annual gillnet and longline survey of the system from 2009 to 2011. Nitrogen stable isotope analysis was used to describe the general trophic ecology of the sharks and large teleost fishes over four continuous regions of the Big Bend. Biopsies were collected in ontogenetic series from the most abundant shark species and many teleost fishes, and will be used to investigate potential shifts in diet and trophic level related to ontogeny. Carbon and sulfur stable isotope analysis will be used, when possible, to describe sources of primary productivity in the Big Bend region, with special regard to two separate regions split by the input of the Suwannee River. Data presented are preliminary.
PHILLIPS, NICOLE; CHAPLIN, JENNIFER; MORGAN, DAVID; PEVERELL, STIRLING. 2012.
(NP,JC,DM) Murdoch University, Murdoch, WA, Australia; (SP) Queensland Department of Primary Industries and Fisheries, Cairns, WA, Australia
Stock structure in the Indo-West Pacific Pristis sawfishes: the importance of habitat use in the evolution of sex-biased dispersal
A number of elasmobranchs across different families exhibit sex-biased dispersal. However, the selective pressures that favor the evolution of sex-biased dispersal in elasmobranchs are not well understood and sex-biased dispersal has been assessed in too few species for a clear pattern(s) to emerge. This study provides the first evidence of sex-biased dispersal in sawfishes and demonstrates how such dispersal may vary with habitat usage in Indo-West Pacific species. The Freshwater Sawfish, Pristis microdon, which utilizes freshwater rivers as juveniles and marine/estuarine waters as adults, was found to have male-biased dispersal in Australian waters. In contrast, P. clavata and P. zijsron, which spend their entire lives in marine and/or estuarine waters, are genetically structured in northern Australian waters. The use of freshwater rivers as juveniles by P. microdon suggests that the evolutionary history of this species in Australian waters was potentially very different to those for P. clavata and P. zijsron and may have influenced the evolution of sex-biased dispersal in the former, but not the latter, species.
PICKARD, ALEXANDRIA; WETHERBEE, BRAD; NEMETH, RICHARD; KADISON, ELIZABETH; BLONDEAU, JEAN; SHIVJI, MAHMOOD. 2012.
(AP,MS) Guy Harvey Research Institute, Nova Southeastern University, FL 33004 USA; (BW) Guy Harvey Research Institute, Nova Southeastern University, FL, and the University of Rhode Island, RI, USA; (RN,EK,JB) University of the Virgin Islands, St. Thomas, Virgin Islands, USA, USA
Characterization of shark movements on a mesophotic Caribbean coral reef and temporal association with fish spawning aggregations
Fish spawning aggregations (FSA) are often composed of hundreds to thousands of individuals and represent the primary source of annual reproductive effort for many species. Migration of sexually mature adults from home sites to spawning grounds for reproduction is predictable in location and timing. Fish spawning aggregations may also play an important role in ecosystem function. For example, grouper spawning aggregations can represent a huge concentration of fish biomass, which fluctuates on a seasonal basis. As such, they may represent a potentially important prey source for large predators, including sharks. Moreover, their large-scale reproductive migrations connect various habitats and local food webs within the larger ecosystem. This study aims to determine how populations migrating to FSA sites function within the ecosystem, by examining the relationship between movement patterns of apex predators (sharks) and multi-grouper species at two FSA sites along the southern shelf edge of St. Thomas, US Virgin Islands. We test the hypothesis that increased shark presence will be detected at FSA sites during grouper spawning seasons. To determine shark presence at spawning aggregations, three species of sharks (tiger, lemon and Caribbean Reef) were tagged with acoustic transmitters (VR13, 16). Their movements were monitored over five years using an array of Vemco receivers (VR2) deployed at spawning sites and at locations spanning a stretch of deep reef approximately 100 km in length. Receiver data will indicate if shark frequency at spawning areas is correlated temporally with grouper spawning seasonality, diurnality or species. Results will increase knowledge of shark reliance on FSA sites and how they utilize the mesophotic reef system as a whole, for habitat and prey.
POMPERT, JOOST; PIERCE, GRAHAM (ABERDEEN UNIVERSITY, CANADA); BRICKLE, PAUL; ARKHIPKIN, ALEXANDER. 2012.
(JP,PB,AA) Falkland Islands Fisheries Department, Canada; (PG) Aberdeen University, Canada
A comparison of the life history strategies of the Falkland skate (Bathyraja macloviana) and the joined-fin skate (Bathyraja cousseauae) using age estimations from caudal thorns.
Life history parameters for the Falkland skate, Bathyraja macloviana and the joined-fin skate Bathyraja cousseauae from specimens caught in waters around the Falkland Islands are presented, with age and growth estimates derived from 496 and 357 caudal thorn samples respectively. Bathyraja macloviana were aged to 14 years, whereas B. cousseauae were aged to 20 years. Growth between the two species was very different, with the von Bertalanffy growth model (K= 0.21, L∞=60.6cm Lt) best describing B. macloviana, and the Gompertz growth function best describing B. cousseauae (G=1.937, k=0.178, L∞=124.5 cm Lt-). In both species the females are heavier at size than the males, and females reach a slightly larger size. Age increments were validated using two techniques: an oxytetracycline tag- recaptured B. cousseauae that had been at liberty for 21⁄2 years, and edge analyses of a subsample of young specimens.
Sizes and ages at 50% maturity derived from maturity stages are also presented. For female B. macloviana this is 50.2cm Lt and 7.0yrs, for males 46.0cm Lt and 6.8yrs. For female B. cousseauae these values are 96.7cm Lt and 10.3yrs, for males 91.4cm Lt and 9.0yrs.
Of the 16 skate species that occur in the Falkland fishery, 8 have to date been age-assessed, with the new life history information on these 2 species providing further insight into the inter-assemblage dynamics. With an increasing amount of ageing studies completed stock management models can be refined.
POMPERT, JOOST; PIERCE, GRAHAM (ABERDEEN UNIVERSITY, CANADA); BRICKLE, PAUL; ARKHIPKIN, ALEXANDER. 2012.
(JP,PB,AA) Falkland Islands Fisheries Department, Canada; (PG) Aberdeen University, Canada
Reproductive strategies of two species of skate (Bathyraja macloviana and Bathyraja cousseauae) inhabiting the Falkland Islands shelf; a comparison
The reproductive strategies for the Falkland skate, Bathyraja macloviana and the joined-fin skate Bathyraja cousseauae from specimens caught in waters around the Falkland Islands are presented. LM50 as derived from reproductive organ development are compared with those derived from maturity stages. For female B. macloviana these are 48.7-52.2cm Lt, for males 46.9-47.6 cm Lt, for male B. cousseauae the values are 90.9-92.7cm Lt. These LM50 values compare well with those derived from maturity stages and are attained at a relatively large size of 75% and 77% of Lt-max respectively. The fecundity of both species is low, at around 7 for B. macloviana and around 21 for B. cousseauae. Of all samples examined, one hermaphrodite B. cousseauae was noted.
Both species display ontogenetic changes with depth, with juvenile B. macloviana present at and over the shelf break, and all other size and maturity classes present mainly on the shelf. Juvenile B. cousseauae are also mainly present at the shelf break, but as specimens grow and mature they migrate to deeper water, returning to shallower water to spawn on the shelf break. Both species also display spawning seasonality, with B. macloviana spawning primarily in spring and summer months, and B. cousseauae primarily spawning in winter and spring months.
Energy investment into reproduction for females of both species is shown by a clear increase in HSI with size, and a decreasing HSI as the animal enters the reproductive phases at LM50, with concomitant increases in GSI.
Dimensions of egg capsules are presented, with the mean capsule length (excluding horns) for B. macloviana 75.4mm, and for B. cousseauae 125.9mm.
The new life history information on these two species discovered by this study improves the understanding of the reproductive biology of these two species, and will help with refining the stock management models. It will also assist with the study of other species in the skate assemblage in the region.
Pömpner, Nadine (Institut für Spezielle Zoologie und Evolutionsbiologie, Friedrich-Schiller-Universität Jena); Beckmann, Felix (Helmholtz Zentrum Geesthacht, Institute of Materials Research, Max-Planck- Straße 1, 21502 Geesthacht, Germany, Canada); Müller, Hendrik (Jena University, Department of Comparative Zoology and Evolutionary Biology, Jena, Germany)
PRATT, HAROLD; HEIST, EDWARD; PRATT, THEO; CARRIER, JEFFREY. 2012.
(HP,TP) Mote Marine Laboratory, Summerland Key, FL, United States; (EH) Southern Illinois University, Carbondale, IL, United States; (JC) Albion College, Albion, MI, United States
Sexual conflict in the nurse shark, Ginglymostoma cirratum: five compensatory behaviors
Different animal sexes often have differing reproductive goals and unequal investments which result in a continuing conflict of interests. In the annual nurse shark mating season at the Dry Tortugas, Florida, sexual conflict is both striking and conspicuous. Males attempt to force copulation by orally grasping or attempting to grasp the chosen female‘s pectoral fin. Females vigorously thwart 94.1% of male mating attempts (n=1280) by Refuging, by Avoiding and by cooperative Pectoral Shielding. In group mating events (6.2 % of total events observed), males counter these female maneuvers with two cooperative behaviors of their own; the Simultaneous Caudal Grab and Blocking. As many as seven males have been observed to pursue a selected female, circle into position and compete to grasp the female‘s pectoral fins to coerce her to mate. In most large group matings observed, one attendant, non-competitive male facilitates male mating from the very first encounter by positioning himself in front of the mating sharks limiting their forward motion. Videography reveals that this male‘s helping role (Blocking) is determined even before the pectoral grasp is attained, or before the identity of the copulating male in the event is decided by contest. Thus males may choose a helping role on the mating grounds. The ̳Simultaneous Caudal Grab‘ permits two males to work together to move an Avoiding female into deeper water. Group courtship results in a copulation at least 40 % of the time (n = 86). Male and female cooperation may have evolved as a reciprocal altruism and not kin selection as microsatellite genotype analysis reveals low levels of relatedness. Refuging and Pectoral Shielding are mutualisms probably derived from schooling.
PROHASKA, BIANCA K.; TSANG, PAUL C.W.; DRIGGERS III, WILLIAM B.; HOFFMAYER, ERIC R.; SULIKOWSKI, JAMES A.. 2012.
(BKP,JAS) University of New England, USA; (PCWT) University of New Hampshire, USA; (WDIII,ERH) National Marine Fisheries Service, Mississippi Laboratories, USA
Potential Utilization of Steroid Hormones Extracted from the Skeletal Muscle Tissue of the Spiny Dogfish (Squalus acanthias), the Little Skate (Leucoraja erinacea), the Atlantic Sharpnose Shark (Rhizoprionodon terraenovae), and the Atlantic Stingray (Dasy
Currently, circulating levels of plasma steroid hormones have been used as a non-lethal method to determine reproductive maturity and reproductive cycles in elasmobranchs. However, this method can prove problematic to perform on large and/or endangered species, because of difficulties involved with specimen handling. These constraints make it imperative for new techniques to be developed for studying the reproductive biology of elasmobranchs. Previous work conducted on other vertebrates has shown that steroid hormones can be successfully extracted from muscle tissue. The process of collecting muscle tissue samples is quick, minimally invasive, and may be conducted without removing the animal from the water, facilitating its use on larger, and/or endangered species of elasmobranchs. The focus of this presentation will be the development of a valid method for extracting steroid hormones from the skeletal muscle tissue of the lecithotrophic aplacental viviparous spiny dogfish, the oviparous little skate, the placental viviparous Atlantic Sharpnose shark, and the matrotrophic aplacental Atlantic stingray. For each species 40 females are currently being collected from the Gulf of Maine, and the Gulf of Mexico and will consist of 10 immature individuals, to act as control replicates, 10 early-gestation individuals, 10 mid- gestation individuals, and 10 near parturition individuals. Sample collections of spiny dogfish, little skate, Atlantic sharpnose sharks, and Atlantic stingray began in October 2010, and the remaining samples will be collected throughout the following year. To verify the use of this tissue for reproductive analysis, steroid hormone levels extracted from skeletal muscle tissue will be compared to the concentrations and patterns of those same steroid hormones extracted from plasma, via radioimmunoassay. Preliminarily, the results suggest that a trend exists between the concentrations of steroid hormone levels in the plasma to those in the skeletal muscle tissue.
QUEIROZ, NUNO; HUMPHRIES, NICOLAS; MUCIENTES, GONZALO; SOUSA, LARA; SIMS, DAVID. 2012.
(NQ,LS) CIBIO – University of Porto, Vairao, Portugal; (NH,DS) Marine Biological Association of the United Kingdom, Plymouth, United Kingdom; (GM) IMM ¿ CSIC, Vigo, Spain
Behaviour, critical habitat and fisheries interactions of pelagic sharks in the North Atlantic Ocean
Surface longlines are widely known to interact with several marine predators and are linked with declines in targeted and bycatch species in the open ocean, including seabirds, turtles, tunas and sharks. Many large pelagic predators, such as blue Prionace glauca and mako sharks Isurus oxyrinchus, are of current conservation concern because of their vulnerability to overfishing and rapid declines in populations. Management of pelagic shark populations is poorly developed and takes little account of behavioural characteristics such as spatial and temporal movements and distributions. Recent studies show that some species remain faithful to particular regions with males and females segregating into different regions for at least part of the year. This raises the issue of whether fisheries concentrate in key critical areas where, for example, the majority of a population aggregate for feeding or mating opportunities, or where important components of a population choose to remain. Consequently, we need to know the extent to which fisheries overlap with different components of blue and mako shark populations in space (both vertically and horizontally) and time. Using vessel monitoring system (VMS) data from Portuguese and Spanish surface longliners operating in the North Atlantic and recorded movements of blue and mako sharks from satellite-linked pop-up (PAT) tags, we aimed at identifying and characterising critical habitats of these species, for testing the extent of space-use overlap with pelagic fisheries, and thus, investigate the vulnerability of sharks to bycatch mortality. Geolocations and behaviour of individual sharks were related to high-resolution maps of environmental variables (e.g. sea surface temperature, frontal boundaries, sea altimetry and productivity) to quantitatively characterise the preferred habitat and, using GIS technology and geostatistics, the degree of spatial and temporal overlap of shark distributions, including migrations, with the spatial extent and density of satellite-tracked longlining fishing vessels was quantified. Longlines were deployed over an extensive area from 0 – 60oN and 2 – 62oW, with fishing effort generally concentrated in three wide-ranging areas in the North Atlantic. Tracked sharks also occupied a broad geographical area, but displayed high space-use of specific regions over 90 to 180 days. Our results indicate that different segments of the blue shark population may be facing differential risk from spatially heterogeneous longlining effort, depending on which geographical regions are occupied at specific times. Preliminary results on the space-use overlap between oceanic-tagged sharks and the longlining fleet operating in North Atlantic waters will be presented.
RIGBY, CASSANDRA; SIMPFENDORFER, COLIN. 2012.
Centre for Sustainable Tropical Fisheries and Aquaculture & School of Earth and Environmental Sciences, James Cook University, AUS
Habitat associations of deepwater chondrichthyan life history traits
Life history traits are important indicators of the productivity of a species, and its ability to tolerate fishing pressure. Using a variety of life history traits (male and female traits of maximum size, size at maturity, age at maturity, longevity, growth rate and size at birth) from a wide range of chondrichthyans we demonstrate that there are life history differences between shelf, oceanic and deepwater habitats. This included deepwater species having lower growth rates, later age at maturity and higher longevity than both shelf and oceanic species. This analytical review used a larger suite of species than previously assessed and also undertook an examination of deepwater species life history traits associated with depth and geographic range. We examined the patterns in life history traits by depth (upper, mid and deep slope), region (North and South Atlantic, North and South Pacific) and latitudinal zone (Polar, Temperate and Tropical). North Atlantic female deepwater chondrichthyans were found to have significantly higher growth rates and lower longevity than those in the South Atlantic and size at birth was smallest in species inhabiting the deeper slope habitats, Polar to Temperate zones and the North Atlantic region. There was a trend for both male and female chondrichthyans of lower growth rate, later age at maturity and higher longevity with increasing depth. However this trend was not significant when phylogenetic relatedness and size were taken into account which suggests that differences in species composition and size among habitats can drive these trends and stresses the importance of accounting for these to clearly determine the influence of habitat on life history traits. These associations of life history traits with habitat, both among deep, shelf and oceanic species and within deepwater species will be discussed within the context of ecological theories and conservation strategies.
ROYER, MARK; NOSAL, ANDREW; LANKFORD, THOMAS; CARTAMIL, DANIEL; WEGNER, NICHOLAS; GRAHAM, JEFFERY. 2012.
(MR) Hawaii Institute of Marine Biology; (AN,DC,NW,JG) Scripps Institution of Oceanography, University of California – San Diego, USA; (TL) Center for Marine Science, University of North Carolina Wilmington, USA
Foraging Ecology of the Leopard Shark (Triakis semifasciata) in the La Jolla Ecological Reserve using Non-Destructive Dietary Analysis
Leopard sharks ( Triakis semifasciata ) are a common inshore benthic predator that is found along the west coast of continental North America with a range extending from Oregon (USA) to the Gulf of California (Mexico). While the feeding habits of northern populations in the bays and estuaries have been examined, little is known about the southern populations that reside in coastal habitats. Every year hundreds of mature female leopard sharks aggregate at the south end of the La Jolla Shores beachwithin the San Diego-La Jolla Ecological Reserve (SDLJER). This marine protected area consists of a variety of coastal habitats including sandflats, rocky surfgrass beds, kelp forests, and a submarine canyon. Tracking studies have revealed fine-scale movement patterns of leopard sharks inside the reserve between the different habitats. Insight on the foraging behavior of these sharks could explain their movement behavior and their functional role in these coastal habitats. Stomach contents were obtained non-lethally using the gastric lavage technique from sharks sampled (n=87, 116-169 cm TL) in the surfgrass bed and sandflat at the mouth of La Jolla Submarine Canyon inside the reserve from July 2010 to July 2011. Of the 87 sharks sampled, 46 (54.7%) contained prey items which were identified to the lowest possible taxon. The percent index of relative importance (%IRI) was calculated for each food type to facilitate comparisons between prey groups and other reported diets from northern populations. The composition of major prey groups in T. semifasciata was heterogeneous, consisting mostly of decapod crustaceans (%IRI =14%), teleost fish (%IRI=27%), squids (%IRI=20%), octopi (%IRI=19%), gastropods (%IRI=4%) and mixed vegetation (%IRI=10%) with 8% as unidentified digested matter. When the %IRI was examined on the species level, it was found that the market squid ( Loligo opalescens ) which uses the submarine canyon as a spawning ground had the highest index of relative importance (18.8%). The association of specific prey items to the habitat types they reside in indicates that leopard sharks utilize each habitat type within the SDLJER as a foraging ground. The prey composition of leopard sharks sampled in the San Diego-La Jolla Ecological Reserve was entirely different from the reported prey compositions of north populations with Cancer gracilis being the only prey item overlap. This study helps gain insight on the movement patterns of leopard sharks between habitats for foraging and the role they have in trophic exchange between coastal habitats. Broader ecosystem based modeling for the southern California coast and the designation of important locations for Marine Protected Areas can utilize this information on the functional role of leopard sharks.
SEMBA, YASUKO; SHONO, HIROSHI; YOKAWA, KOTARO. 2013.
(YS,KY) National Research Institute of Far Seas Fisheries, Shizuoka, Japan; (HS) Kagoshima University, Kagoshima, Japan
Distributional pattern of shortfin mako, Isurus oxyrinchus, by ontogenetic stage and sex in the western and central North Pacific
Shortfin mako, Isurus oxyrinchus , is a large pelagic shark with wide distribution from the tropical to temperate oceans. This species are suggested to have long life span and be sexually dimorphic in various aspects such as maximum size and life history traits. Recent studies on life history traits suggest that females grow larger and live longer than males with much longer time to attain sexual maturity. These aspects are suggested to be closely linked to their behavioural aspects, which was supported by the report on the sexual segregation of this species. Considering the long life span and difference of life history schedule between the sexes, ontogenetic stage is also important factor to affect the distributional pattern of this species.
This study focused on the ontogenetic aspects of the distributional pattern of this species and described the temporal and spatial pattern by ontogenetic stage (i.e. juveniles and adults) and also by sex, based on the fishery and research data in the western and central North Pacific Ocean. In the juvenile stage, both males and females frequently occurred in the northwestern part ( higher than 30°N and west of the dateline ), while the distribution of females in the subadult stage tended to shift to the south and the east. In adult stage, males exclusively occurred in the southeastern part ( lower than 30°N and east of the dateline ) with some seasonal fluctuation, while females, both pregnant and non-pregnant, were caught widely across the North Pacific from subtropical and temperate areas. The results in this study suggest the clear ontogenetic difference in the distributional pattern and possible sexual difference in each ontogenetic stage.
SHAW, ASHLEY; SANCHO, GORKA; FRAZIER, BRYAN. 2012.
(AS,GS) College of Charleston, USA; (BF) South Carolina Department of Natural Resources, USA
Trophic ecology of an estuarine predatory fish community in South Carolina assessed by stable isotope analysis
Estuaries serve as habitats and nurseries for many recreationally and commercially important fish, contributing recruits into adult populations that remain in close proximity to estuarine environments. Understanding the diet and trophic relationship dynamics of the fish populations within the estuarine community is essential to effectively managing these species. Upper-level predatory fish are among the most sought-after fisheries species, and studying the trophic ecology of this community can infer the probability of competition and niche partitioning within this highly productive ecosystem. To establish these trophic relationships, relative trophic levels and dietary niche overlap of the predator community in the Cape Romain National Wildlife Refuge (specifically Bulls Bay and its surrounding tidal creeks) were assessed using stable isotope analysis. The main predators examined in this study include teleosts such as red drum, spotted seatrout, and southern flounder, in addition to elasmobranchs, which include bonnethead, scalloped hammerhead, Atlantic sharpnose, sandbar and finetooth sharks. Fish, collected with cooperation of South Carolina Department of Natural Resources via trammel nets, gillnets and longlines in the channels and along the banks of the estuary, were measured, muscle biopsied, and then released. Tissue samples were taken from the dorsal musculature with a 4 mm biopsy punch and frozen until analysis. Samples were examined for carbon (C 13 ) and nitrogen (N 15 ) isotope ratios. Isotopic signatures of potential prey were collected and used to elucidate the predators‘ diets. In addition, stomach content of predators was collected during sampling when a live release was not possible. Results may have implications for ecosystem-based management of the Cape Romain estuarine system that can be applicable to other estuaries.
SHIFFMAN, DAVID; GALLAGHER, AUSTIN; WESTER, JULIA; HAMMERSCHLAG, NEIL. 2012.
(DS,AG,JW,NH) University of Miami, USA
Catch and release recreational shark fishing in Florida: economic, social, and policy implications
Catch-and-release fishing represents a non-extractive use of sharks that furthers the frequently-used conservation principle that sharks may be worth more alive (to ecotourism businesses) than dead (to extractive fishermen). Recreational fishing is economically and socially important in the state of Florida, and sharks are a popular sportfish. 137 charter fishing businesses throughout the state of Florida that advertise shark fishing trips were identified. Using content analysis of charter fishing business websites and trade publications, as well as surveys of charter fishing captains, the extent of the catch and release shark fishery was estimated. Catch and release practices are commonly utilized by charterboat fishing captains, with only two businesses explicitly advertising “catch and kill” practices. The most commonly targeted species of sharks are mostly locally abundant, with the exception of great and scalloped hammerheads, which are declining in population and are the least likely to survive catch and release fishing. The wording used by charterboat businesses on company websites and trade publications was analyzed to show attitudes towards catch and release fishing. For many businesses, shark fishing trips are the most expensive service offered, suggesting that sharks are economically valuable to these charterboat captains. Survey results are also discussed. Applicable fisheries management policies are reviewed.
SHIVJI, MAHMOOD; HORN, REBEKAH. 2012.
Save Our Seas Shark Center USA and Guy Harvey Research Institute, Nova Southeastern University, USA
A meta-analysis of matrilineal population genetic structure in fishery exploited sharks
Assessment, management and conservation of resources by their individual populations/stocks is a central goal of fishery managers. This goal also applies to shark fisheries, but management of sharks on a population basis is still infrequent partly because information on their population delineation is limited (although growing). This limitation is particularly acute for species that have widespread distributions and constitute major components of the global fishery catch. Contrary to expectations given the apparent potential for long-distance movement by many large shark species, studies that have examined their population structure are revealing notable levels of genetic differentiation at various spatial scales. We present a ―first-look‖ meta-analysis of maternal lineage (mitochondrial DNA-based) population genetic structure in sharks based on published and unpublished data. At the minimum, inter-ocean basin or inter- hemispheric population differentiation based on mitochondrial markers is present in nearly all species with global distributions. For some species, statistically significant, matrilineal population structure has been detected within ocean basins, and in some cases this structure is present over relatively small geographic scales (1000-2500 km) and even continuous coastlines. Although more detailed information on shark population structure is still required (i.e., studies with many more sampling locations and more statistical power using more markers and/or larger sample sizes), the growing evidence that sharks consist of genetically differentiated populations bodes well for assessment and management of sharks on a population-specific basis, the ability to track the population origin of shark products in fisheries and trade for fishery law enforcement efforts, and monitoring landings and markets to detect if certain populations in less-regulated fisheries are being inadvertently overexploited.
SIMPFENDORFER, COLIN; RIGBY, CASSANDRA. 2012.
(CS) Centre for Sustainable Tropical Fisheries and Aquaculture; (CR) James Cook University, Cairns, Q, Australia
How low is too low? Depletion reference points for deepwater chondrichthyans
Deepwater chondrichthyans are among the most vulnerable to human impacts because of their late ages of maturity and low reproductive rates. While this vulnerability is being increasingly recognized, understanding how to best manage these populations is still limited. Here we use life history data to calculate levels of population productivity and estimate the levels of depletion at which Maximum Sustainable Yield (MSY) occur. These estimates of the population levels at which MSY are achieved provide target reference points for conservation and management of deepwater chondrichthyans. The patterns in these reference points with factors such as depth, taxonomy and reproductive mode are examined. Gaps in our knowledge that will help improve the conservation and management of deepwater species are also identified.
SMITH, KIERAN; KAJIURA, STEPHEN. 2012.
Florida Atlantic University Elasmobranch Research Lab, USA
Elasmobranch Bycatch Mitigation
Commercial longline fishing results in large amounts of incidental bycatch with elasmobranch fishes (sharks, skates, and rays) constituting approximately 25% of the total catch. A variety of techniques have been proposed to reduce catch rates of non-target species. Teleost species, like swordfish and tuna, lack electrosensory systems so developing technologies which target the ampullary organs in sharks may provide an avenue to selectively deter elasmobranchs without impacting the catch rate of target teleosts. Lanthanide metals are extremely reactive when immersed in salt water and produce an electric field detectable by the elasmobranch electrosensory system. The employment of lanthanide metals to reduce shark bycatch has shown mixed results. It is therefore essential that these metals undergo further investigation in order to properly determine their effectiveness as a tool for elasmobranch bycatch mitigation. A controlled scientific longline study will be conducted to test the efficacy of the lanthanide metal neodymium at reducing elasmobranch catch per unit effort (CPUE). Baited longline hooks will be treated with neodymium and catch rates will be compared to that of controls. Preliminary data suggest shark CPUE was decreased by 66% on neodymium treated hooks compared to untreated hooks, whereas teleost catch rate did not differ. The effectiveness of neodymium varies among species with significant reductions shown for blacktip ( Carcharhinus limbatus ) and Atlantic sharpnose sharks ( Rhizoprionon terranovae ) but less dramatic differences for other species indicating that interspecies variability may exist. Galvanic interaction between the lead control and stainless steel leader created an electric field well within the range detectable by elasmobranchs. Based upon the large voltage produced by dissimilar metals in seawater, we devised an alternative electrogenic stimulus. The juxtaposition of two metals with different galvanic potentials creates in seawater an electric field nearly identical to the lanthanide metals. Because a nearly identical voltage can be generated with common metals, producing similar catch reductions at a fraction of the cost, this alternative technology is potentially a viable tool for reduction of incidental shark bycatch in commercial longline fishing.
SPEAKS, JUSTIN. 2012.
University of West Florida
Photoperiod and Temperature Effects on Steroid Hormone Production and Dental Plasticity in theMale Atlantic Stingray, Dasyatis sabina
Photoperiod and temperature are recognized as two of the most important environmental cues in temperate freshwater and marine ecosystems. While manipulations of environmental factors, and their relative control over reproductive physiology, have been studied in many teleost fishes, elasmobranchs are not as well represented. The Atlantic stingray has a protracted and well-defined mating season beginning in early Autumn and ending in late Spring, and can be observed in males not only by increases of androgens, but by changes in dentition. In this experiment the proximate affects of temperature and photoperiod on dentition and reproductive hormones were quantified in the Atlantic Stingray. It is proposed that if photoperiod and temperature are the dominant proximate factors for reproduction in this species, they should directly activate androgen production. The increase in androgens following gonadal recrudescence should, in turn, trigger the dental modification seen in mating male stingrays. Results indicate that temperature is a strong proximate cue for onset of testosterone production in laboratory studies, however wild samples indicated photoperiod plays an important role as well. Laboratory animals showed the highest hormone response in treatments that simulated both decreasing daylength and temperatures. High temperatures in the laboratory showed a distinct inhibitory effect on testosterone production. Dental morphology displayed a trend of increasing percentage of samples with cuspidate dentition as the wild population moved into the breeding season, following a period of increased androgen production. Laboratory samples also responded in a similar fashion, although not as clearly as the wild population. Samples with low testosterone levels over the course of the experiment showed a higher percentage of molariform dentition, while those exhibiting increased testosterone had a higher percentage of cuspidate and transitioning dentition. This study further elucidates the influence of photoperiod and temperature on gonadal recrudescence in an elasmobranch. It is the first experiment to examine associations between circulating hormone levels and changes in dental morphology, a secondary sex characteristic that has received little attention. This research should provide an impetus to develop new lines of investigation into the discrete physiological mechanisms that control reproduction in elasmobranch fishes.
STEHMANN, MATTHIAS F.W.. 2012.
ICHTHYS Laboratory
Dipturus nidarosiensis (Storm, 1881), a NE Atlantic deepwater composite skate species
Storm prepublished without figures in 1881a note on Raja nidarosiensis Collett (nov. sp. in lit.), based on correspondence with Collett. Collett himself published in 1882 the full description of Raja nidrosiensis as a new skate from Trondhjem Fjord, along with good plate drawings of his three syntypes (immature male 138 cm, two females 181.5 and 191 cm TL). Cannas et al. published online in early 2010 molecular and morphological evidence of the occurrence of Dipturus nidarosiensis (Storm, 1881) in the Mediterranean Sea, based on 14 specimens taken from the deep Sardinian Channel at 600 to 1420 m depth. These measured 240 to 1482 mm TL, including 9 adult females and the adult male of 1180 mm TL. The habitus photographs by Cannas et al. (2010) of a female 100 cm, a young male 24 cm and the mature male 118 cm TL from off Sardinia raised the author‘s doubts about the correct identity of these specimens. The author had seen D. nidarosiensis from the northern North Atlantic and reported in the literature, and these showed a quite different habitus and were of markedly larger size of more than 2 metres, with beginning sexual maturity at a size even somewhat larger than the maximum size of the Sardinian specimens. Iglésias (2009) had published on D. batis Linnaeus being a composite species of a very large D. intermedia and a much smaller D. flossada, just like with D. nidarosiensis. When contacted, Iglésias wrote to eventually have found D. oxyrinchus to also be a composite species with two forms of different size. And he confirmed to have provided the Sardinian colleagues tissue samples of D. nidarosiensis for their comparative DNA analyses. He also confirmed to only know as D. nidarosiensis from French catches and landings in and from southern Rockall Trough the smaller form of the Sardinian morphotype, but he had never seen the larger, probably more northern morphotype. Agreement of DNA analyses of his samples and the Sardinian specimens was thus explained. Both morphotypes will be demonstrated, along with some contradictions in Collett‘s description, and the different geographical range of both D. nidarosiensis forms. It looks like, instead of fomerly three Eastern North Atlantic species of Dipturus, we have to deal now with six species, with wide ranging consequences for fishery management and conservation measures.
STRAUBE, NICOLAS; CORRIGAN, SHANNON; LI, CHENHONG; ROCHEL, ELISABETH; ROSANA, KERRI; NAYLOR, GAVIN. 2012.
College of Charleston, Charleston, SC, United States
Putting some jaws on the Tree of Life: Taxon-rich estimates of elasmobranch phylogeny based on mitochondrial and nuclear DNA markers
Exploring patterns and processes of evolutionary change in the elasmobranch fishes may be critical to understanding vertebrate diversification and success. The elasmobranchs hold an important position in the gnathostome tree because they are basal, sister to the Osteichthyes while also showing similarities with the mammals in terms of genome organization. In spite of this importance, and widespread fascination with sharks among the scientific and general communities, we know relatively little about the interrelationships among constituent members of the group. To date, most molecular based estimates of elasmobranch phylogeny have been based on mitochondrial DNA sequence data. While such estimates are useful, they constitute a single gene tree, which may or may not accurately depict true species level relationships. To be reliable, estimates of phylogeny must be based on multiple independent markers. In the few cases where independent nuclear gene markers have been used to estimate the relationships among elasmobranchs, taxon-sampling has been sparse and the resulting trees have been highly discordant. We present, for the first time, a phylogeny based on 8 protein coding loci (7 nuclear, 1 mitochondrial) among 150 of the 190 described genera of elasmobranchs, representing 56 of 57 extant families. We identify the phylogenetic signal that is common to all 8 markers and discuss the differences in signal among genes.
STUMP, KRISTINE; CROOKS, CHRISTOPHER; GRUBER, SAMUEL. 2012.
(KS) University of Miami – RSMAS; (CC) University of Manchester, Manchester, United Kingdom; (SG) Bimini Biological Field Station, Miami, FL, United States
Hunted hunters: an experimental test of the effects of predation risk on juvenile shark habitat use
The effects of predation on a species occur either directly, through consumption, or indirectly as risk effects. Risk effects arise when prey alter their behavior in an attempt to decrease encounters, detection and/or capture. Often, a perceived predation threat leads to risk effects which manifest as changes in habitat use by the prey species, and these effects can be significant and even greater in consequence than direct effects. In Bimini, Bahamas, neonate and juvenile lemon sharks (Negaprion brevirostris) use mangrove-fringed shorelines as nursery areas in part due to the protection afforded from predators, namely larger conspecifics. We investigated the small-scale use of mangrove structure by neonate and juvenile lemon sharks as an anti-predatory response to predation risks. Controlled experimental trials were conducted on captive sharks to assess the degree of the sharks‘ use of artificial mangroves when solitary, with a size-matched conspecific and with a potential predator (subadult conspecific). Results showed a significant increase in use of artificial mangroves when in the presence of a potential predator as compared to when with a size-matched conspecific. In addition, a significant negative correlation was found between body size and the use of artificial mangrove structure when in the presence of a potential predator, indicating that size is an important factor in anti-predatory behavior.
TESTERMAN, CHRISTINE; FITZPATRICK, SEAN; PRODÖHL, PAULO; SIMPFENDORFER, COLIN; SHIVJI, MAHMOOD. 2012.
(CT,MS) Save Our Seas Shark Center USA & Guy Harvey Research Institute, USA; (SF,PP) Queen’s university; (CS) James Cook University, Australia
Global Phylogeography and Mating System Analysis of the Great Hammerhead Shark (Sphyrna mokarran)
The population status of the great hammerhead shark ( Sphyrna mokarran ) worldwide is of management and conservation interest due to its high bycatch mortality and high market value fins. We evaluated the population genetic structure of S. mokarran based on samples from the central western Atlantic (US Atlantic, Gulf of Mexico and Caribbean), Indian Ocean (Red Sea, Persian Gulf and western Australia) and south western Pacific (eastern Australia) using complete mitochondrial control region sequences (n=277) and twelve nuclear microsatellite loci (n=286). The population structure results based on mitochondrial and microsatellite markers were concordant, revealing strong geographic partitioning between samples from the central western Atlantic and Australia. We found shallow but statistically significant genetic structuring within oceanic basins, albeit with some differences between the two marker types in fine scale patterns involving Red Sea and Persian Gulf samples. Standard molecular diversity indices and coalescent analyses suggest that the species originated in the western Pacific with subsequent radiation into the Indian and Atlantic oceans. We also conducted parentage analysis of four complete litters (litter sizes n=55; n=23, n=20, n=19) and one partial litter (n=6) using the nuclear microsatellite markers. The parentage analysis showed multiple paternity in all 5 litters with a range of 2- 6 sires per litter, suggesting a genetically polyandrous mating strategy in S. mokarran . Evidence of geographic patterns of genetic structure in this species suggests that genetic data may prove useful to source the broad geographic origin of S. mokarran fins in trade and assist with delineation of stocks for individual population assessment and general conservation efforts.
TESTERMAN, CHRISTINE; WINTNER, SABINE; MCAULEY, RORY; CARTAMIL, DAN; SHIVJI, MAHMOOD. 2012.
(CT,CD,MS) Save Our Seas Shark Center USA & Guy Harvey Research Institute, USA; (WS) University of KwaZulu-Natal, South Africa; (RM) Western Australia Fisheries and Marine Research Laboratories, Canada
Global Population Genetic Analysis of the Smooth Hammerhead Shark (Sphyrna zygaena)
The smooth hammerhead ( Sphyrna zygaena ) is a globally distributed shark frequently caught as bycatch and in fisheries, and its fins are valued in the international fin trade. Despite its wide distribution and importance in fisheries, published information on its population dynamics is scarce. We evaluated the global population genetic structure and demographics of S. zygaena using complete mitochondrial control region sequences (1,090 nucleotides) and 19 nuclear microsatellite loci. Our genetic assessment is based on a widely distributed set of 397 samples from the North and South Atlantic, northern, central and southern regions of the eastern Pacific, and the southwest Indian and western Pacific Oceans. The mitochondrial sequence and microsatellite-based findings were generally concordant, revealing strong genetic partitioning between samples from the Atlantic and Indo-Pacific, and shallower but statistically significant genetic structuring within oceanic basins. As coastal nursery areas have been reported for this species, we also investigated the extent of female natal site philopatry and male mediated gene flow using mixed-marker analyses. Statistical analyses of genetic diversity in S. zygaena are also providing insight into current and historical population trends that may be informative for conservation and fishery management efforts.
TESTERMAN, CHRISTINE; BRUNNSCHWEILER, JUERG; GULAK, SIMON; WERRY, JONATHAN; JABADO, RIMA; JONES, CATHERINE; SHIVJI, MAHMOOD. 2012.
(CT,MS) Save Our Seas Shark Center USA & Guy Harvey Research Institute, USA; (JB) ETH Zurich; (SG) Southeast Fisheries Science Center, National Marine Fisheries Service/NOAA, Canada; (JW) Griffith University; (RJ) United Arab Emirates University; CJ) University of Aberdeen
Global Population Genetic Structure and Parentage Analysis of the Bull Shark (Carcharhinus leucas)
Population structure, demographic trends and mating system biology are important information components of national and international management and conservation efforts. The bull shark ( Carcharhinus leucas ) is a globally distributed, large coastal shark that occurs in marine, estuarine and freshwater habitats. It has been assessed as near threatened by the IUCN, is caught in recreational and commercial fisheries throughout its range, and shows evidence of recent declines in the Gulf of Mexico. Recent reports have provided evidence of strong geographic structuring between northern and southern populations of C. leucas in the western Atlantic at the maternally inherited mitochondrial control region locus, but no structure within the western Atlantic at 5 nuclear microsatellite loci. We expanded on this study by evaluating the global population genetic structure of C. leucas based on 490 samples from the central western Atlantic (northern Gulf of Mexico and US Atlantic coast) and the Indo-west Pacific (South Africa, Persian Gulf, Arabian Sea, Indonesia, eastern and western Australia, and Fiji) using twelve nuclear microsatellite loci. We also genotyped 4 individuals from the eastern Pacific. The microsatellite data revealed strong geographic partitioning between samples from the Atlantic and Indo-Pacific and shallow but statistically significant genetic structuring within oceanic basins. We present statistical analyses of genetic diversity that provide insight into current and historical population trends. Finally, parentage analysis of 2 litters (12 pups each) suggests that the species may be genetically polyandrous.
THOMAS, W. KELLEY; KING, BENJAMIN; GENOME, SKATE. 2012.
(WKT) UNH/Hubbard Center for Genome Studies; (BK) Mount Desert Island Biological Laboratories; (SG) Northeast Bioinformatics Collaborative
The Skate Genome Project
The little skate ( Leucoraja erinacea ) is a member of the most primitive surviving clade of jawed vertebrates, thecartilaginous fishes, that first appeared approximately 450 million years ago. Cartilaginous fishes exhibit manyfundamental vertebrate characteristics, including a neural crest, jaws and teeth, an adaptive immune system, and a pressurized circulatory system. The skate is a powerful comparative model to study biological processes shared among jawed and limbed vertebrates such as renal physiology, immunology, toxicology and regeneration. The North East Bioinformatics Collaborative of the North East Cyberinfrastructure Consoritum (NECC) is a team ofbioinformatics experts from five member states and is currently sequencing the genome of the skate to enable comparative genomic studies. We are characterizing the genome using the whole genome shotgun sequencing approach and Illumina high-throughput sequencing. To date, we have 59x coverage of the estimated 3.4 Gbp genome by generating over 200 Gbp of sequence in 1.8 billion sequencing reads that are primarily from a paired-end fragment library with a 500bp insert size. An initial de novo genome assembly yielded three million contiguous (contig) sequences. Together the contigs represent 40% of the estimated genome. One of these contigsrepresents the entire 16.7kb mitochondrial genome. We are currently constructing mate-pair sequencing libraries that will be used to build scaffolds. So far, a 3.5 kbp mate-pair library was generated and sequenced at low depth. Theskate genome sequence project has served as an important model for highly collaborativebiomedical research, especially with regards to improved biomedical workforce development through cyber-enabled research. Three week- long workshops provided bioinformatics training in genome andprotein sequence analysis and annotation to faculty, students and other researchers among NECC institutions.
TOMITA, TAKETERU; SATO, KEIICHI; SUDA, KENTA; KAWAUCHI, JUNRO; NAKAYA, KAZUHIRO. 2012.
(TT,SUDA,JK,KN) Hokkaido University, Hakodate, 4, Japan; (SATO) Okinawa Churaumi Aquarium, Motobu, 1, Japan
Feeding of the megamouth shark (Pisces: Lamniformes: Megachasmidae) predicted by its hyoid arch: A biomechanical approach
Studies of the megamouth shark, one of three planktivorous sharks, can provide information about their evolutionary history. Megamouth shark feeding has never been observed in life animals, but two alternative hypotheses on biomechanics suggest either feeding, i.e., ram feeding or suction feeding. In this study, the second moment of area of the ceratohyal cartilages, which is an indicator of the flexural stiffness of the cartilages, is calculated for 21 species of ram- and suction-feeding sharks using computed tomography. The results indicate that suction-feeding sharks have ceratohyal cartilages with a larger second moment of area than ram-feeding sharks. The result also indicates that the ram–suction index, which is an indicator of relative contribution of ram and suction behavior, is also correlated with the second moment of area of the ceratohyal. Considering that large bending stresses are expected to be applied to the ceratohyal cartilage during suction, the larger second moment of area of the ceratohyal of suction-feeding sharks can be interpreted as an adaptation for suction feeding. Based on the small second moment of area of the ceratohyal cartilage of the megamouth shark, the feeding mode of the megamouth shark is considered to be ram feeding, similar to the planktivorous basking shark. From these results, an evolutionary scenario of feeding mechanics of three species of planktivorous sharks can be suggested. In this scenario, the planktivorous whale shark evolved ram feeding from a benthic suction- feeding ancestor. Ram feeding in the planktivorous megamouth shark and the basking shark evolved from ram feeding swimming-type ancestors and that both developed their unique filtering system to capture small-sized prey.
VAUDO, JEREMY; WETHERBEE, BRADLEY; HOWEY, PAUL; SHIVJI, MAHMOOD. 2012.
(JV) Guy Harvey Research Institute; Florida International University; (BW) Guy Harvey Research Institute; University of Rhode Island, USA; (PH) Microwave Telemetry, Inc., Columbia, MD, United States; (MS) Guy Harvey Research Institute; Nova Southeastern University, USA
Vertical movements of tiger sharks (Galeocerdo cuvier) tagged in the US Virgin Islands
Tiger sharks (Galeocerdo cuvier) are a wide ranging species that display a variety of horizontal movement patterns, making use of coastal and pelagic waters. Far less, however, is known about their vertical movements. To investigate the vertical movement behavior of tiger sharks around the US Virgin Islands, seven individuals (4 males, 3 females) were tagged in 2008 with high rate, pop-up satellite archival tags (HR X-Tag, Microwave Telemetry, sampling rate: every 3.5 to 4 min; 30-day programmed duration). Five of the seven tags reported and uploaded 19 to 83% of archived data, providing fine-scale depth and temperature data from a total of 105 days. Two sharks displayed post-release dive irregularities lasting ~2 days. Sharks spent the majority of their time making yo-yo dives (repeated oscillatory dives) within the upper 50 m with 18 to 44% of their time spent within the upper 5 m. As a result, sharks typically occupied a narrow temperature range (27 to 29°C for four sharks tagged in June and 25 to 27°C for one shark tagged in March). Dives to greater than 200 m were common and all sharks made dives to at least 400 m, with one shark briefly exceeding 700 m and experiencing temperatures less than 9°C. Although diel patterns were identified in four of the five sharks, whether deeper dives were made during the day or night varied among individuals. Overall, tiger sharks in the vicinity of the US Virgin Islands displayed a high degree of variability in their dive patterns, but typically could be found in the upper 50 m and making regular dives to the deeper waters available to them.
VELEZ ZUAZO, XIMENA; ALFARO SHIGUETO, JOANNA; MANGEL, JEFFREY; PAPA, RICCARDO; AGNARSSON, INGI. 2012.
(XVZ,RP,AI) University of Puerto Rico,Puerto Rico; (JAS,JM) ProDelphinus
What barcoding is revealing about the shark fishery in Peru
Many sharks and rays are globally threatened as a result of overfishing and bycatch. Currently, there is a growing interest in sustainable conservation of sharks but important gaps in knowledge hinder decision- making at the government level including a lack of basic knowledge of the diversity of species targeted as well as incidentally captured by comercial fisheries. In Peru, in the southeast Pacific, the small-scale fisheries comprise ca. 10,000 vessels and, for most elasmobranchs species, it goes largely unregulated and unmonitored. Moreover, for the elasmobranchs fisheries, insufficient monitoring of landings coupled with limited taxonomic identifications have resulted in a poor understanding of the diversity of species caught in Peruvian waters. Molecular analyses, particularly the use of a genetic barcode approach, can play an important role in improving our knowledge of the diversity of elasmobranchs species occupying the marine habitats of Peru and captured by the small-scale fisheries. We analyzed samples collected from six ports along the coast of Peru between 2004 and 2009. We successfully amplified 715bp of the cytochrome oxidase I region of the mitochondrial DNA and identified 110 specimens at the species level. Nine species of sharks were identified. In many cases landed specimens had been misidentified. In port, the smooth hammerhead ( Sphyrna zygaena ) was identified correctly every time, the blue shark ( Prionace glauca ) was correctly identified 86% of the time and the shortfin mako ( Isurus oxyrinchus ) 66% of the time. For other specimens with a non-informative common name (i.e. shark), molecular identification clarified the species. Interestingly, all samples from thresher shark were identified as pelagic thresher ( Alopias pelagicus ) although in Peru the common thresher ( A. vulpinus ) is the species reported as more common and commercially important. We identified one specimen of the dusky shark ( Carcharhinus obscurus ) which represents a new species report for Peru. Of the nine sharks species identified, five are considered a threatened by the IUCN Red List. This study represents the first large- scale initiative to barcode Peruvian marine species and generated a molecular-based taxonomic list of elasmobranches targeted by fisheries in Peru.
VELEZ-ALAVEZ, MARCELA; ZENTENO-SAVIN, TANIA; DE ANDA-MONTAÑEZ, JUAN A.; GALVAN-MAGAÑA, FELIPE. 2012.
Centro de Investigaciones Biologicas del Noroeste, S.C., La Paz, Baja California Sur, Mexico Vitamin C concentration in muscle of teleost and elasmobranch fishes
The fishes include a variety of species which differ phylogenetically, that inhabit different environments, and have different capacities for vigorous excercise. Fishes, like all other aerobic organisms, are susceptible to the formation of reactive oxygen species (ROS). ROS production in muscle increases during physical activity due to the increased oxygen flow and metabolic rate associated to exercise. Vitamin C acts as a metabolic antioxidant, protecting cell membranes and processes that are sensitive to oxidation. The hypothesis of this study is that fish species that have the capacity for sustained vigorous exercise have higher antioxidant defenses, both enzymatic and non-enzymatic, as compared to less active fish species. The aim of this study was to determine the concentrations of the antioxidant vitamin C in muscle of different species of teleosts and elasmobranchs that swim at different speeds. Vitamin C content was analyzed by high performance liquid chromatography (HPLC) in muscle samples of three teleosts (Tetrapturus audax, Coryphaena hippurus, Totoaba macdonaldi) and three elasmobranchs (Isurus oxyrinchus, Prionace glauca, Mustelus henlei). Higher concentrations of vitamin C were found in the most active fish, I. oxyrinchus (N = 20, average 0.395 mg 100 g-1 wet tissue), P. glauca (N = 29, average 0.636 mg 100 g-1 wet tissue), and C. hippurus (N = 24, average 0.417 mg 100 g-1 wet tissue). Vitamin C concentration in muscle samples from T. macdonaldi and M. henlei was below detection limit. These results are in accordance to previous studies, in which, vitamin C concentrations were found to be higher in cartilaginous compared to bony fishes, probably due to the evolutionary process of the antioxidant defense strategies of each group. We found that more physically active species have higher vitamin C concentrations, which probably contribute to balancing ROS production and avoidance of oxidative damage during vigorous exercise. In conclusion, more active, mainly elasmobranch fishes, have higher concentrations of the antioxidant vitamin C.
VERÍSSIMO, ANA; COTTON, CHARLES; BUCH, ROBERT; BURGESS, GEORGE; GULLART, JAVIER. 2012.
(AV) CIBIO – Research Center in Biodiversity and Genetic Resources; (CC) Virginia Insitute of Marine Science, USA; (RB) National Oceanic and Atmospheric Administration, Canada; (GB) Florida Museum of Natural History, Gainesville, FL, United States; JG (Universitat de València)
A revision of the gulper sharks (genus Centrophorus) in North Atlantic waters
The genus Centrophorus (Squaliformes: Centrophoridae) comprises a group of medium-sized benthopelagic sharks usually found on continental and insular slopes of the Atlantic, Indian and Pacific oceans. Many of the 10-12 recognized species are routinely caught in mid- and deep-water fisheries worldwide and some have shown a considerable decline in abundance in the last few decades. Despite the need for efficient and sustainable management of these species, clear and consistent species discrimination and taxonomic identification of Centrophorus is still problematic. The poor resolution of diagnostic morphological characters coupled with the absence or poor condition of the type material and the lack of detail in the original species descriptions contribute to the widespread confusion in the alpha taxonomy of the genus.
We used molecular and meristic characters as well as detailed morphometric measurements to re- evaluate and characterize the diversity of Centrophorus in the North Atlantic, including the Gulf of Mexico and the Mediterranean Sea. Molecular characters were obtained from nucleotide sequences of the mitochondrial DNA cytochrome oxidase I (COI) and 16S ribosomal RNA (16S) gene regions. Data were collected from fresh specimens caught by commercial and research vessels, from preserved specimens deposited in museum and research institute collections, and from publicly available databases (e.g. GenBank; BOLD) and the scientific literature.
Nucleotide polymorphisms at COI and 16S separated North Atlantic Centrophorus specimens into five well-supported groups consistently retrieved by both markers. Morphometric measurements corroborated the existence of these five groups but also indicated the presence of additional groups not represented in the molecular matrix. We provide a morphological characterization of each group and present a combination of morphometric measurements useful for species discrimination in the field.
Comparison of North Atlantic specimens with those collected elsewhere showed that four of the five groups identified above also occur in the Indian and/or Pacific oceans. Our results extend the reported range of some species considerably and suggest that most Centrophorus species have wider geographic distributions than previously reported. Assignment of species names to each of the morphotypes retrieved here is pending further evaluation of Indian and Pacific specimens and a thorough analysis of all extant Centrophorus types.
VILA POUCA, CATARINA; QUEIROZ, NUNO; MUCIENTES, GONZALO; HUMPHRIES, NICK; SIMS, DAVID. 2012.
(CVP,NQ) CIBIO – University of Porto, Vairão, Portugal; (GM) Instituto de Investigaciones Marinas, CSIC, Vigo, Spain; (NH,DS) Marine Biological Association of the United Kingdom, Plymouth, United Kingdom
High-resolution diving behaviour revealed by satellite tagging of blue sharks
Recent advances in satellite tagging technologies have provided increased resolution in studying the movements, patterns of activity and behaviour of individual animals in relation to different environmental features. Such accurate records of long term vertical movements of large predators at fine temporal resolutions have enabled the identification of variable behavioural patterns amongst species, such as diel temporal shifts in behaviour. In addition, by investigating diving behaviour in relation to changing oceanographic variables and to potential foraging success, we are beginning to understand why such behaviours occur at particular times and places. The characteristics of dive profiles, including dive shape, have often been useful to address such questions. For most species, dives can be classified into predefined dive types based on their two dimensional shape, and these types, or the dive characteristics within a type, may reflect activities such as foraging, travelling or resting. Concerning marine fish, two main dive types, V- and U-shaped, have been largely identified. Overall it is thought that V-shaped dives are associated with transiting/prey searching behaviour, while U-shaped profiles are related to foraging on aggregated prey. The identification of different habitat uses, namely transiting and foraging areas, by analysing the spatial distribution of the dive profiles is of great importance to the recognition of key marine habitats. Thus, the ability to identify such critical habitats, by combining data from many different species including large pelagic predators, may be a valuable tool when identifying potential marine protected areas. Here we analysed high resolution data (10s) on depth and temperature experienced by satellite tagged blue sharks Prionace glauca in the eastern Atlantic Ocean and obtained a detailed description of their vertical movements. A total of 2890 dives by 4 blue sharks were recorded. Five dive types, previously described for other species, were found to be commonly performed by blue sharks. Type 1 (U- shaped) and 2 (V-shaped) dives were the most frequently performed by blue sharks (ca. 48% and 32% of the total number of dives, respectively) with all other dive types each representing <6% of the total. Dives that did not conform to the generic classification scheme represented 9.8% of total dives. Further analyses examined spatial and temporal patterns of diving profiles in the eastern Atlantic Ocean.
WALSH, CATHY; LUER, CARL; YORDY, JENNIFER; MIEDEMA, JODI; LEIGH, BRITTANY; ADAMS, PHILIP. 2012.
Mote Marine Laboratory, USA
Epigonal Conditioned Medium from Bonnethead Shark Induces Apoptosis in T-cell Leukemia Cells, and Preferentially Targets Breast Cancer Cells Compared with Normal Breast Cells
Protein factors secreted into the surrounding medium by short-term cultures of epigonal cells (epigonal conditioned medium, ECM) from bonnethead shark ( Sphyrna tiburo ) are cytotoxic against human tumor cells in vitro . Using a T-cell leukemia cell line (Jurkat) as target cells, apoptotic pathway intermediates affected by ECM treatment were identified through western blotting, and protein and PCR arrays. Western blotting and gene expression indicated significant decreases in the apoptosis inhibitor, XIAP, at both the protein and genetic levels in response to ECM treatment. A significant increase in expression of the adaptor protein, FADD, was observed at the protein level in response to 2 mg/ml ECM. Protein array analysis indicated treatments at both 1 mg/ml and 2 mg/ml ECM resulted in greater than 120% relative increase in expression of Fas, as well as apoptosis promoters bad and bax. At the same ECM treatments, analysis using a human apoptosis array kit showed significant changes in expression of some caspase genes, adaptor proteins, and death receptors. To determine effect of ECM on normal cells, growth inhibition was measured in paired malignant/non-malignant cell lines derived from human breast tissue (Hs 578T/Hs 578Bst), with statistically greater growth inhibition demonstrated in transformed cells (Hs 578T) compared with normal cells (Hs 578Bst) in response to both 1 and 2 mg ECM protein/ml. A PCR array focused on death receptor pathways showed significant up-regulation of CASP8, BID, and TRAF2 in transformed cells compared with normal cells in response to 2 mg/ml ECM treatment. Several decoy receptor genes (TNFRSF10C, TNFRSF6B, TNFRSF10D) were also down-regulated in transformed cells compared to normal cells following treatment with 2 mg/ml ECM.
Weideli, Ornella; Gruber, Samuel; Stump, Kristine; Chapman, Demian; Feldheim, Kevin; Salzburger, Walter
(OW,WS) University of Basel, Basel, Switzerland; (SG) Bimini Biological Field Station, Miami, FL, United States; (KS) University of Miami, Miami, FL, United States; (DC) Stony Brook University, Stony Brook, NY, United States; (KF) The Field Museum, Chicago, IL, United States
Has resort related large-scale mangrove habitat destruction resulted in a change of the prey community and therefore in a dietary shift of nursery bound juvenile lemon sharks, Negaprion brevirostris (a BACI study)?
Non-lethal eversion for collecting and sampling shark stomach contents is a common method used in dietary studies. By also sampling available prey communities, the overlap between observed diet and prey availability can be investigated. Recent studies have shown that sharks are capable of foraging as selective predators, not simply feeding on the most available prey, which makes dietary studies more interesting and complex. The waters around Bimini, Bahamas (25 ̊44‘N, 79 ̊16‘W) provide an ideal nursery location for juvenile lemon sharks (Negaprion brevirostris). The near-shore nursery areas offer large seagrass beds fringed by mangroves, a favorable habitat for a large number of subtropical coastal organisms such as teleosts (e.g. juvenile reef fish) and small invertebrates. However, large scale development has resulted in the removal of shoreline mangroves (up to 50 %) and dredging of seagrass beds (~750,000 m3). This has led to a drastic habitat alteration in one of the main lemon shark nurseries. The aim of this study was to investigate whether this anthropogenic habitat alteration has led to a change in the diet of nursery-bound juvenile lemon sharks. Samples were collected in both the impacted nursery and a nearby but undisturbed control nursery prior and post development, making it possible to conduct a Before-After, Control-Impact (BACI) study. The current dataset originates from two different time periods: before (year 2000-2003) and after the development (year 2010-2011). The former data collection is pre- development, and the later as a post-development subsample of the original dataset. Post-development samples obtained for this study consist of 111 full and 90 empty stomachs and a prey community collection of 9,920 individuals (teleosts and invertebrates) weighting 152,694 grams. Prey community and stomach contents of both sampling periods were identified to the lowest taxonomic level, both visually and through DNA sequencing, and were then grouped into families, enabling the comparison of post- and pre-development data using an index of relative importance (%IRI). Dietary analyses of prey groups revealed in both studies that teleosts dominated the diet by number, weight and occurrence, followed by crustaceans as the most important invertebrate prey group. Results indicate that post-development, juvenile lemon sharks were feeding from lower number of available prey species with an increased level of scavenging from anthropogenic sources.
WEIGMANN, SIMON; STEHMANN, MATTHIAS; THIEL, RALF. 2012.
(SW,RT) Zoological Museum Hamburg, Germany; (MS) ICHTHYS – Ichthyological Research Laboratory and Consultancy, Hamburg, Germany
Okamejei n. sp., a new deep-water skate (Elasmobranchii, Rajidae) from the northwestern Indian Ocean off Sokotra Islands, with comments on congeners in the area
A new species of the Indo-Pacific skate genus Okamejei will be presented from around the Socotra Islands and the slope off northeastern Africa. The 10 specimens of the new species were sampled aboard the Russian RV ̳Vityaz‘. As is typical for the genus all specimens have dark ventral pores, a relatively long, slender tail, a wide interdorsal space, and a long postdorsal tail section. The new species differs from its congeners in having a unique rosette-like dorsal pattern of numerous dark brown spots. The dorsal ground color is ocher, but the anterior snout is dusky. Compared to its sympatric congeners the new species for example has a shorter preorbital snout length, an intermediate distance between first gill slits, a greater orbit diameter, an intermediate number of upper jaw tooth rows and less pectoral radials. Furthermore, comments on the questionable record of the Okamejei pita holotype from the very inner Persian Gulf at the estuary off Iraq and its taxonomic status will be given. Additionally, a brief overview of some other new taxa from the so-called ̳Vityaz‘ collection will be given. This collection, which became property of the Zoological Museum Hamburg in the 1990s, is a very rich collection of the diverse but largely unknown deepwater chondrichthyan fauna in the western Indian Ocean. Geographically, this deepwater survey ranged from the Gulf of Aden to the southern end of the Madagascar Ridge at Walters Shoal. It included remote and largely unknown localities, such as around the Socotra Islands, the slope off Somalia and Kenya, the deep southern Mozambique Channel, the Madagascar Ridge and the Saya de Malha Bank. Quite a number of new taxa of deepwater sharks, skates and rays, and holocephalans have been discovered, along with first geographical records of many taxa in partly large series.
WENG, KEVIN; COMFORT, CHRISTINA. 2012.
(KW) Pelagic Fisheries Research Program, U of Hawaii; (CC) University of Hawaii, USA
Habitat of a globally distributed deep water shark, Hexanchus griseus, in Hawaii
Demersal and deepwater sharks have received less attention than high profile epipelagic species, although their overlap with fisheries and high vulnerability to overexploitation makes them high priority species for research and conservation. Hexanchus griseus may be a top predator on most of the world‘s continental shelves and slopes, but we have limited understanding of its biology. It is found from the equator to boreal zones, and from near the surface to almost 2000 m, deepening its habitat towards the equator. In Hawaii the species has been observed from submersibles and with baited cameras, and captured across a range of sizes from juvenile to adult. Conventional and satellite tagging reveals that H. griseus typically has high residency but makes occasional long distance movements. Foraging behavior is dominated by strong diel vertical migrations that bring the species up to 200 m at night, potentially into contact with deep reef and epipelagic species.
WETHERBEE, BRADLEY; HARVEY, GUY; BURNIE, NEIL; AMING, CHOY; BYRNE, MIKE; SHIVJI, MAHMOOD. 2012.
(BW) University of Rhode Island/Guy Harvey Research Institute; (GH,MS) Guy Harvey Research Institute, USA; (NB,CA) Bermuda Shark Project, Hamilton, United Kingdom; (MB) University of Georgia, USA
Contrary to ordinary – long-term movements of tiger sharks reveal both variable and consistent movements
Tracking of 58 tiger sharks ( Galeocerdo cuvier ) in the Western Atlantic, Caribbean and Australia using satellite transmitters has revealed that their movements are highly variable among locations and individual sharks. Sharks tracked in Bermuda demonstrate the most consistent behaviors characterized by seasonal north-south migrations although movements among sharks vary. Bermuda tagged sharks show an impressive ability to utilize two very different marine ecosystems for nearly equal periods of time, spending warmer months in the open ocean covering long distances, in contrast to winter months primarily concentrated in coastal waters of The Bahamas. Individual sharks tracked for extensive periods of time (< 1 yr) exhibited remarkable consistency of movement between years, following similar migratory pathways and occupying similar seasonal areas. Areas searched intensively by sharks in oceanic waters were an order of magnitude larger than areas searched intensively in insular waters. Long-term tracking of tiger sharks has illustrated a combination of both behavioral plasticity and consistency resulting in connectivity of disparate and distant marine ecosystems on multiple scales.
WHITE, EASTON; NAGY, JOHN; GRUBER, SAMUEL. 2012.
(EW) Arizona State University; (JN) Scottsdale Community College, Arizona State University, USA; (SG) Bimini Biological Field Station
A stage-structured stochastic model of lemon shark population dynamics
While some general mathematical models of shark population dynamics have been important in fisheries management, there is a need for more detailed treatments to assess causes of population fluctuations. For example, nursery sites are an important habitat element for juvenile lemon sharks ( Negaprion brevirostris ), exposing this species to potential anthropogenic impacts not faced by pelagic species. However, nursery site use has been largely overlooked in mathematical population models. Here we define a novel stage-structured, Markov chain stochastic model to study how this life history characteristic interacts with demographic stochasticity to generate fluctuations in lemon shark populations. We show that demographic stochasticity accounts for 27 to 40% of the variance observed in a 17-year, longitudinally studied population of lemon sharks. We therefore, conclude that unmodeled environmental factors can be important drivers of interannual population fluctuations. These factors may include habitat loss, weather patterns, global climate change, and random catastrophic events. Our model is easily applicable to many large vertebrate predators in which age structure and demographic stochasticity are important considerations. It may also be used to estimate demographic parameters that cannot be feasibly estimated in the field
WHITE, WILLIAM; LAST, PETER. 2012.
CSIRO Marine & Atmospheric Research, Hobart, T, Australia
A review of taxonomy of chondrichthyan fishes: a modern perspective
Taxonomic clarity is a fundamental requirement as it forms the foundation of all other life sciences. In the last decade, chondrichthyan taxonomy has undergone a ̳scientific renaissance‘ with more than 180 new species formally described. This effort encompasses about 15% of the global chondrichthyan fauna which consists of 1185 currently recognised chondrichthyan species. The important role of chondrichthyan taxonomy for conservation management has been highlighted in recent years with new species descriptions or taxonomic resolution of a number of threatened species. These include Australian gulper sharks (genus Centrophorus ) and speartooth sharks (genus Glyphis ) in coastal waters of Australia and Borneo. Closer examination of other wide-ranging species for which the taxonomy was thought to be stable, have shown that they consist of species complexes, e.g. manta rays ( Manta ) and spotted eagle rays ( Aetobatus narinari complex), and highlights the need for critical re-examination of other ̳wide- ranging‘ species. Molecular methods have provided another useful tool to taxonomists and they have proven to assist greatly with identifying cryptic species and species complexes. However, the limitations of particular molecular methods being used need to be carefully considered and there are some concerns about how these are being integrating with classical taxonomy. The fundamental importance of taxonomic nomenclature to life sciences is often poorly understood but striving for nomenclatural stability is a critical component of taxonomy. Similarly, biological collections are an extremely vital asset to both taxonomists and the broader scientific community. These collections have becoming increasingly important due in part to molecular species identification initiatives such as the Barcode of Life which has resulted in a large number of voucher specimens linked to tissue samples being deposited. Biological collections are also proving to be imperative in biodiversity studies as they contain a ̳gold mine‘ of historical collection information important for assessing changes in faunal assemblages. Resources are typically limited for taxonomic research and the ̳ageing‘ taxonomic community is another issue of concern for the future of taxonomy on this important group. Succession planning and better resource allocation will be essential to ensure that this fundamental discipline is maintained into the future.
WIMMER, TONYA; CORKE, JARRETT; COOPER, ERNIE; MCFARLANE, GORDON A.. 2012.
(TW,JC) WWF-Canada, Halifax, NS, Canada; (EC) WWF-Canada / TRAFFIC, Vancouver, BC, Canada; (GAF) Fisheries and Oceans Canada, Nanaimo, BC, Canada
Developing priorities for the conservation and management of sharks in Canada
Globally, over the last two decades, shark conservation and management has emerged as a major priority for marine conservation. In 1999 the Food and Agriculture Organization (FAO) developed an international framework for shark conservation. This framework recommends that all States with fisheries impacting shark species should participate in their management and develop National Plans of Action (NPOA) to identify information gaps, issues and priorities for their conservation and management within their jurisdiction. Despite international commitments, there has been little action undertaken to better understand, manage and protect elasmobranch species in Canadian waters. The only exceptions to this are species for which there is commercial interest (e.g. Pacific spiny dogfish and porbeagle) or species which interact with commercial fisheries (e.g. shortfin mako, tope and sixgill). Canada has developed an NPOA which has some useful information on commercial shark stocks. However, it does not specify actions, priorities or timelines to assess or mitigate threats to non-commercial species, nor does it adequately address issues throughout Canada. Furthermore, Canada‘s NPOA was developed with no stakeholder input, which is a critical step to developing comprehensive and meaningful plans as identified by the FAO.
To address this, WWF-Canada hosted regional forums on the Atlantic and Pacific coasts that brought together experts from government, industry, conservation, tourism and academia to discuss the conservation of sharks. In total, 42 people participated in the Atlantic Shark Forum and 37 in the Pacific Shark Workshop (including several international experts). The goal of each forum was to discuss the most pressing issues for sharks in regards to science, on-the-water practice and policy & management and to determine the top priorities which would significantly advance the conservation and management of shark species in Canadian waters. Despite regionally specific differences, the top priorities for both regions fell into three broad categories: 1) more and better information on stock status and catch data for all species; 2) increased education, training and information sharing about sharks, conservation issues and initiatives; and 3) advance understanding and research on mitigation measures and handling practices to minimize mortality of sharks. This information and the collaborations that have resulted will be essential to the development of national and regional action plans to address threats to these species.
WUERINGER, BARBARA; SQUIRE, LYLE; COLLIN, SHAUN P.. 2012.
(BW,SPC) University of Western Australia, Crawley, Q, Australia; (LS) Cairns Marine, Stratford, Q, Australia
Intraspecific interactions between sawfish
In Australia, freshwater sawfish Pristis microdon inhabit the upper reaches of rivers during their juvenile life. In these turbid environments, they are known to move into shallow water, and anecdotal evidence suggests that they may form groups or aggregations. However, the behavioural mechanisms behind such aggregations have never been investigated. Bonnethead sharks Sphyrna tiburo form hierarchies within a group, based on smaller specimens giving way to larger ones when swimming on a course that would cause a collision. Our behavioural analyses of juvenile freshwater sawfish in their first months in captivity found that in 58 % of cases that may lead to a potential collision, both approaching are sawfish equally likely to move out of the way, while in only 26% of cases a smaller sawfish would give way to let a larger animal pass. This indicates that sawfish may use other strategies to establish hierarchies that avoid potential collisions with their toothed rostra. One such strategy will be described in detail, based on findings that sawfish touch each other on various parts of the body with their rostra. Moreover, analyses of interactions in feeding sawfish clearly indicate the dominance of larger individuals, which use behaviours of varying aggression to steal food from smaller individuals. Larger sawfish succeeded in stealing food from smaller conspecifics in 60% of their attempts, while smaller sawfish never succeeded in stealing food from a larger animal. During such interactions, sawfish may use their rostrum to pin the rostrum of another sawfish onto the substrate, which results in the pinned animal moving backwards to escape and the loss of its prey in the process. The present study indicates that removal of the rostrum of a live sawfish (which seems to become more common in countries where sawfish are protected but interact with recreational fishermen) may not only affect its ability to sense and manipulate prey but also to successfully interact with conspecifics. If adult sawfish interact with each other in ways similar to juveniles, removing the rostrum may also effectively remove them from the reproductive pool.
YOPAK, KARA; MCMEANS, BAILEY; KOVACS, KIT; LYDERSEN, CHRISTIAN; FISK, AARON. 2012.
(KY) University of Western Australia; (BM,AF) University of Windsor; (KK,CL) Norwegian Polar Institute
Can we infer function from elasmobranch brain morphology? A study of Somniosidae
Broad variability has been documented within cartilaginous fishes regarding the size and complexity of the brain and its major components (olfactory bulbs, telencephalon, diencephalon, mesencephalon, cerebellum and medulla) . This variability is often associated with habitat or specific behavior patterns, even in phylogenetically unrelated species that share certain lifestyle characteristics. However, few studies to date have examined neural specialization in closely related species that vary in their lifestyle and primary habitat. Somniosidae is a member of the Order Squaliformes, which comprises 7 genera and 17 species. They are benthopelagic fishes that range greatly in size, distribution, and depth preference (occurring as deep as 2200m). However, few studies have quantified interspecific brain size (encephalization) or the relative development of major brain areas and discrete subsections of these brain structures that receive direct sensory input (e.g. optic tectum and the dorsal and medial octavolateral nuclei) within this group. This study examined the brain of two large-bodied somniosids that are known to occupy extremely cold waters of the High Arctic, S. pacificus and S. microcephalus, in comparison to the brain morphology of closely related, deep-dwelling species from more southerly latitudes, such as Centroselachus crepidater , Centroscymnus owstonii , and Proscymnodon plunketi . Brain patterns were analyzed in relation to both phylogeny and ecology. In general, members of Somniosidae had smaller than expected brains for their body mass. Although closely related, the relative development of major brain areas did not track phylogenetic groupings. In particular, development of brain regions that receive visual input were relatively reduced in S. microcephalus , while the olfactory regions of the brain were greatly enlarged. This species occurs at great depths and is heavily colonized by parasitic copepods that attach to the shark’s cornea; its brain morphology might reflect a reduced reliance on vision for survival. Although this study was not a functional analysis, we suggest brain morphology may serve as a tool to make predictions about the behavioral ecology, sensory specialization, and predatory habits in cartilaginous fishes.